multiplex diagnostics based on crispr effector system

专利摘要:
the modalities disclosed herein utilize RNA targeting effectors to provide a robust CRISPR-based diagnosis with atomole sensitivity. the modalities disclosed herein can detect broth DNA and RNA with comparable levels of sensitivity and can differentiate targets from non-targets based on single base pair differences. further, the modalities disclosed herein may be prepared in lyophilized format for convenient distribution and point-of-care (poc) applications. such modalities are useful in multiple human health settings, including, for example, viral detection, bacterial strain typing, sensitive genotyping, and detection of disease-associated cell-free DNA.
公开号:BR112020012696A2
申请号:R112020012696-9
申请日:2018-12-20
公开日:2020-11-24
发明作者:Feng Zhang；Bernd Zetsche；Jonathan Gootenberg；Omar Abudayyeh
申请人:The Broad Institute Inc.；Massachusetts Institute Of Technology；President And Fellows Of Harvard College；
IPC主号:

专利说明:

[0001] [0001] This application claims the benefit of Provisional Application No. 62/610,066, filed December 22, 2017; Provisional Application No. 62/623,546, filed on January 29, 2018; Provisional Application No. 62/630,814, filed on February 14, 2018; and Interim Order No. 62/741,501, filed October 4, 2018. The entire contents of each of the above orders are incorporated by reference herein. STATEMENT ON GOVERNMENT-SPONSORED RESEARCH FEDERAL
[0002] [0002] This invention was made with government support under grant numbers MH110049 and HL141201 granted by the National Institutes of Health. The government has certain rights to the invention. REFERENCE TO A LISTING OF SEQUENCES
[0003] [0003] The contents of the Electronic Sequence Listing (BROD-2445WP.ST25.txt”; size is 1.8 megabytes and was created on November 27, 2018) is hereby incorporated by reference in its entirety. FIELD OF TECHNIQUE
[0004] [0004] The subject disclosed here is generally directed to quick diagnoses related to the use of CRISPR effector systems.
[0005] [0005] Nucleic acids are a universal signature of biological information. The ability to rapidly detect nucleic acids with high sensitivity and single-base specificity in a portable platform has the potential to revolutionize the diagnosis and monitoring of many diseases, provide epidemiological information valuable and serve as a generalizable scientific tool. Although many methods have been developed for the detection of nucleic acids (Du et al., 2017; Green et al., 2014; Kumar et al., 2014; Pardee et al., 2014; Pardee et al., 2016; Urdea et al., 2006), they inevitably suffer tradeoffs between sensitivity, specificity, simplicity and speed. For example, qPCR approaches are sensitive but expensive and rely on complex instrumentation, limiting usability to highly trained operators in laboratory settings. Other approaches, such as new methods that combine isothermal nucleic acid amplification with portable (Du et al., 2017; Pardee et al., 2016), offer high detection specificity in a point-of-care (POC) environment, but have some limited applications due to low sensitivity. variety of healthcare applications, detection technologies that provide high specificity and sensitivity at low cost would be of great use in clinical and basic research settings. SUMMARY
[0006] [0006] In one aspect, the invention provides a nucleic acid detection system comprising: two or more CRISPR systems and a masking construct. Each CRISPR system comprises an effector protein and a leader molecule comprising a leader sequence designed to bind to corresponding target molecules; a masking construct; and optionally, nucleic acid amplification reagents to amplify target molecules in a sample. Each masking construct further comprises a sequence of nicking motifs that is preferably nicked by one of the activated CRISPR systems.
[0007] [0007] The two or more CRISPR effector systems can be RNA-targeted effector proteins, DNA-targeted effector proteins, or a combination thereof. DNA-directed effector may be a Cas12 protein, such as Cpf1 and C2c1.
[0008] [0008] In other embodiments, the system may further comprise nucleic acid amplification reagents. The nucleic acid amplification reagents may comprise a primer comprising an RNA polymerase promoter. In certain embodiments, the nucleic acids of the sample are amplified to obtain a DNA template comprising an RNA polymerase promoter, by which a target RNA molecule can be generated by transcription. The nucleic acid can be DNA and amplified by any method described herein. The nucleic acid can be RNA and amplified by a method of reverse transcription as described herein. The aptamer sequence may be amplified after unmasking the primer binding site, whereby a trigger RNA is transcribed from the amplified DNA product. The target molecule may be a target DNA and the system may further comprise a primer that binds to target DNA and comprises an RNA polymerase promoter.
[0009] [0009] In an exemplary embodiment, the effector protein of the CRISPR system is an RNA-targeted effector protein. Example RNA-targeted effector proteins include Cas13b and C2c2 (now known as Cas13a). It will be understood that the term "C2c2" herein is used interchangeably with "Cas13a". In another example embodiment, the RNA-targeted effector protein is C2c2. In other embodiments, the C2c2 effector protein is from an organism of a genus selected from the group consisting of: Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifator, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flaviivola Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter and Lachnospira, or the effective protein C2c2 is an organism selected from the group consisting of: Leptotrichia shahii.
[0010] [0010] In other embodiments, the one or more guide RNAs are designed to bind to one or more target molecules that are diagnostic for a disease state. In still other embodiments, the disease state is an infection, an organ disease , a blood disorder, a disease of the immune system, a cancer, a disease of the brain and nervous system, an endocrine disease, a disease related to pregnancy or childbirth, an inherited disease, or an environmentally acquired disease. In still other embodiments, the disease state is cancer or an autoimmune disease or an infection.
[0011] [0011] In other embodiments, the one or more guide RNAs are designed to bind to one or more target molecules comprising cancer-specific somatic mutations. The cancer-specific mutation may confer drug resistance. Drug resistance mutation may be induced by treatment with ibrutinib, erlotinib, imatinib, gefitinib, crizotinib, trastuzumab, vemurafenib, RAF/MEK, checkpoint blocking therapy, or anti-estrogen therapy. Cancer-specific mutations may be present in one or more genes encoding a selected protein from the group consisting of programmed death ligand 1 (PD-L1), androgen receptor (AR), Bruton's tyrosine kinase (BTK), epidermal growth factor receptor (EGFR), BCR-Abl, c-kit, PIK3CA , HER2, EML4-ALK, KRAS, ALK, ROS1, AKT1, BRAF, MEK1, MEK2, NRAS, RAC1 and ESR1. The cancer-specific mutation may be a mutation in a gene selected from the group consisting of CASP8, B2M, PIK3CA , SMC1A, ARID5B, TET2, ALPK2, COL5A1, TP53, DNER, NCOR1, MORC4, CIC, IRF6, MYOCD, ANKLE1, CNKSR1,NF1, SOS1, ARID2, CUL4B, DDX3X, FUBP1, TCP11L2, HLA-A, B or C, CSNK2A1, MET, ASXL1, PD-L1, PD-L2, IDO1, IDO2, ALOX12B and ALOX15B or copy number gain,
[0012] [0012] In other embodiments, the one or more guide RNAs can be designed to bind to one or more target molecules comprising loss of heterozygosity (LOH) markers.
[0013] [0013] In other embodiments, the one or more guide RNAs can be designed to bind to one or more target molecules comprising single nucleotide polymorphisms (SNP). The disease could be heart disease and the target molecules could be VKORC1, CYP2C9 and CYP2C19.
[0014] [0014] In other embodiments, the disease state may be a disease related to pregnancy or childbirth or an inherited disease. Therefore, the sample may be a blood or lymph node sample. The disease may be selected from the group consisting of in Trisomy 13, Trisomy 16, Trisomy 18, Klinefelter syndrome (47, XXY), (47, XYY) and (47, XXX), Turner syndrome, Down syndrome (Trisomy 21), Cystic Fibrosis, Huntington's Disease, Beta Thalassemia, Myotonic Dystrophy, Sickle Cell Anemia, Porphyria, Fragile X Syndrome, Translocation
[0015] [0015] In other embodiments, the infection is caused by a virus, a bacterium or a fungus, or the infection is a viral infection. In specific embodiments, the viral infection is caused by a double-stranded RNA virus, a virus of positive-sense RNA, a negative-sense RNA virus, a retrovirus, or a combination thereof, or the viral infection is caused by a Coronaviridae virus, a Picornaviridae virus, a Caliciviridae virus, a Flaviviridae virus, a Togaviridae virus, a Bornaviridae, a Filoviridae, a Paramyxoviridae, a Pneumoviridae, a Rhabdoviridae, an Arenaviridae, a Bunyaviridae, an Orthomyavovida virus or a Deltavirus or Coronary,SARS, poliovirus, rhinovirus, hepatitis A, Norwalk virus, yellow fever virus, Nile virus West, Hepatitis C virus, Dengue virus, Zika virus, Rubella virus, Ross River virus, Sindbis virus, Chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, Measles virus, mumps virus Nipah, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hantavirus, Crimean-Congo hemorrhagic fever virus, influenza or hepatitis D virus.
[0016] [0016] In other embodiments of the invention, the RNA-based masking construct suppresses the generation of a detectable positive signal or the RNA-based masking construct suppresses the generation of a detectable positive signal by masking the detectable positive signal or generating a negative signal detectable, or the RNA-based masking construct comprises a silencing RNA that suppresses the generation of a gene product encoded by a reporting construct, wherein the gene product generates the detectable positive signal when expressed.
[0017] [0017] In other embodiments, the RNA-based masking construct is a ribozyme that generates the detectable negative signal and wherein the detectable positive signal is generated when the ribozyme is inactivated or the ribozyme converts a substrate to a first color and in which the substrate converts to a second color when the ribozyme is inactivated.
[0018] [0018] In other embodiments, the RNA-based masking agent is an RNA aptamer, or the aptamer sequesters an enzyme, wherein the enzyme generates a detectable signal upon release of the aptamer, acting on a substrate, or the aptamer sequesters a pair of agents that when released from the aptamers combine to generate a detectable signal.
[0019] [0019] In another embodiment, the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and a masking component are attached. In another embodiment, the detectable ligand is a fluorophore and the masking component is an inhibitory molecule , or reagents for amplifying target RNA molecules, such as, without limitation, NASBA or RPA reagents.
[0020] [0020] In another aspect, the invention provides a diagnostic device comprising one or more individual discrete volumes, each individual discrete volume comprising a CRISPR effector protein, one or more guide RNAs designed to bind to the corresponding target molecule, a masking construct based on RNA and, optionally, further comprise nucleic acid amplification reagents.
[0021] [0021] In another aspect, the invention provides a diagnostic device comprising one or more individual discrete volumes, each individual discrete volume comprising a CRISPR effector protein, one or more guide RNAs designed to bind a trigger RNA, one or more aptamers detection comprising a masked RNA polymerase promoter binding site or a masked primer binding site, and optionally further comprising nucleic acid amplification reagents.
[0022] [0022] In some embodiments, the individual discrete volumes are droplets, or the individual discrete volumes are defined in a solid substrate, or the individual discrete volumes are microwells, or the individual discrete volumes are defined points on a substrate, such as a substrate of paper.
[0023] [0023] In one embodiment, the RNA targeting effector protein is a CRISPR type VI RNA targeting effector protein, such as C2c2 or Cas13b. In certain exemplary embodiments, the C2c2 effector protein is from an organism selected from the group consisting of in: Leptotricia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifator, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flaviivola Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter, or the C2c2 effector protein is selected from the group consisting of: Leptotrichia shahii, L. wadei, Listeria seeligeri, Lachnospiraceae bacterium, Clostridium aminophilum, Carnobacterium gallinarum, Paludibacter propionicigenes, Listeria weihenstephanensis, Listeriaceae bacterium, and Rhodobacter capsulatus, the C2c2 effector protein is a effector protein L. wadei F0279 or L. wadei F0279 (Lw2) C2c2. In another fashion Indeed, the one or more guide RNAs are designed to bind to one or more target RNA sequences that are diagnostic for a disease state.
[0024] [0024] In certain example embodiments, the RNA-based masking construct suppresses the generation of a detectable positive signal or the RNA-based masking construct suppresses the generation of a detectable positive signal by masking the detectable positive signal or generating a negative signal detectable, or the RNA-based masking construct comprises a silencing RNA that suppresses the generation of a gene product encoded by a reporting construct, wherein the gene product generates the detectable positive signal when expressed.
[0025] [0025] In another exemplary embodiment, the RNA-based masking construct is a ribozyme that generates a detectable negative signal and wherein the detectable positive signal is generated when the ribozyme is inactivated. In one exemplary embodiment, the ribozyme converts a substrate to a first color and wherein the substrate converts to a second color when the ribozyme is inactivated. an enzyme, where the enzyme generates a detectable signal upon release of the aptamer, acting on a substrate, or the aptamer sequesters a pair of agents that when released from the aptamers combine to generate a detectable signal.
[0026] [0026] In another exemplary embodiment, the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand oligonucleotide and a masking component are attached. In certain exemplary embodiments, the detectable ligand is a fluorophore and the masking agent is an inhibitory molecule.
[0027] [0027] In another aspect, the invention provides a method for detecting target molecules in samples, comprising: dispensing a sample or set of samples into one or more individual discrete volumes, the individual discrete volumes comprising two or more CRISPR systems comprising an effective protein , one or more guide RNAs, a masking construct; incubating the sample or set of samples under conditions sufficient to allow binding of one or more guide RNAs to one or more target molecules; activating two or more CRISPR effector proteins through the binding of one or more guide RNAs to one or more target molecules, wherein activation of the CRISPR effector protein results in modification of the RNA-based masking construct such that a detectable positive signal is produced; and detecting the detectable positive signal, wherein detection of the detectable positive signal indicates the presence of one or more target molecules in the sample.
[0028] [0028] In certain exemplary embodiments, these methods further comprise amplification of sample RNA or trigger RNA. In other embodiments, RNA amplification comprises amplification by NASBA or RPA.
[0029] [0029] In certain exemplary embodiments, the RNA targeting effector protein is a CRISPR type VI RNA targeting effector protein, such as C2c2 or Cas13b. In other exemplary embodiments, the C2c2 effector protein is from an organism selected from the group consisting of: Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifator, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flaviivola, Flaviivola, Flaviivola, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter, or the C2c2 effector protein, is selected from the group consisting of: Leptotrichia shahii, L. wadei, Listeria seeligeri, Lachnospiraceae bacterium, Clostridium aminophilum, Carnobacterium gallinarum, Paludibacter propionicigenes, Listeria weihenstephanensis, Listeriaceae bacterium, and Rhodobacter capsulatus. In a specific embodiment, the C2c2 effector protein is an effective L. wadei F0279 or L. wadei F0279 (Lw2) C2C2 protein. In certain exemplary embodiments, the Cas12 protein is Cpf1.Cpf1 may be selected from an organism of the genus consisting of; Streptococcus, Campylobacter, Nitratifrator,
[0030] [0030] In certain exemplary embodiments, the Cas12 protein is a C2c1 protein. C2c1 can be selected from an organism of the genus consisting of Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae. certain exemplary embodiments, C2c1 may be selected from one or more of the following; Alicyclobacillus acidoterrestris (eg ATCC49025), Alicyclobacillus contaminans (eg DSM17975), Alicyclobacillus macrosporangiidus (eg DSM17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (eg DSM10711), Desulfonatronum thiodismutans (eg example, MLF-1 strain), Elusimicrobia bacteriumRIFOXYA12, Omnitrophica
[0031] [0031] In certain exemplary embodiments, the one or more guide RNAs are designed to bind to one or more target molecules that are diagnostic for a disease state. In certain other exemplary embodiments, the disease state is an infection, an organ disease, a blood disease, a disease of the immune system, a cancer, a disease of the brain and nervous system, an endocrine disease, a related disease pregnancy or childbirth, an inherited disease, or an environmentally acquired disease, cancer or fungal infection, bacterial infection, parasitic infection, or viral infection. In certain exemplary embodiments, the masking construct suppresses generation of a detectable positive signal, or the masking construct suppresses generation of a detectable positive signal by masking the detectable positive signal or generating a detectable negative signal, or the masking construct comprises a silencing RNA that suppresses the generation of a gene product encoded by a reporting construct, where the gene product generates the detectable positive signal when expressed, or the masking construct is a ribozyme that generates the detectable negative signal and where the positive detectable signal is generated when the ribozyme is inactivated. In other exemplary embodiments, the ribozyme converts a substrate to a first state and where the substrate converts to a second state when the ribozyme is inactivated, either the masking agent is an aptamer, or the aptamer sequesters an enzyme, where the ribozyme is inactivated. The enzyme generates a detectable signal upon release of the aptamer acting on a substrate, or the aptamer sequesters a pair of agents that when released from the aptamers combine to generate a detectable signal. In still other embodiments, the RNA masking construct comprises an RNA or DNA oligonucleotide with a detectable ligand at a first end of the RNA or DNA oligonucleotide and a masking component at a second end of the RNA or DNA oligonucleotide, or the detectable ligand is a fluorophore and the masking component is a quencher molecule.
[0032] [0032] In another aspect, the invention provides a lateral flow device comprising a substrate having a first end, wherein the first end comprises a sample loading portion and a first region loaded with a detectable ligand, two or more systems CRISPR effectors, two or more detection constructs, one or more first capture regions, each comprising a first binding agent, two or more second capture regions, each comprising a second binding agent, wherein each of the two or more CRISPR effector systems comprise a CRISPR effector protein and one or more leader sequences, each leader sequence configured to bind one or more target molecules.
[0033] [0033] In some embodiments, each of the two or more detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule at a first end and a second molecule at a second end. In specific embodiments, the lateral flow device may comprise two CRISPR effector systems and two detection constructs. In even more specific embodiments, the lateral flow device may comprise four CRISPR effector systems and four detection constructs.
[0034] [0034] The sample loading portion may further comprise one or more amplification reagents to amplify the one or more target molecules.
[0035] [0035] In some embodiments, a first detection construct comprises FAM as a first molecule and biotin as a second molecule or vice versa and a second detection construct comprises FAM as a first molecule and Digoxigenin (DIG) as a second molecule or vice versa. In some embodiments, the CRISPR effector protein is an RNA-targeting effector protein. In some embodiments, the RNA-targeting effector protein is C2c2. In some embodiments, the RNA-targeting effector protein is Cas13b.
[0036] [0036] In some embodiments, a first detection construct may comprise Tye665 as a first molecule and Alexa-fluor-488 as a second molecule or vice versa; a second detection construct may comprise Tye665 as a first molecule and FAM as a second molecule or vice versa; a third detection construct may comprise Tye665 as a first molecule and biotin as a second molecule or vice versa; and a fourth detection construct may comprise Tye665 as a first molecule and DIG as a second molecule or vice versa.
[0037] [0037] In some embodiments, the CRISPR effector protein may be an RNA-targeted or a DNA-targeted effector protein. The RNA-targeted effector protein may be C2c2 or Cas13b. In some embodiments, the DNA-targeted effector protein is Cas12a.
[0038] [0038] These and other aspects, objects, features and advantages of exemplary embodiments will become apparent to those skilled in the art upon consideration of the following detailed description of illustrated exemplary embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] [0039] FIG.1 - is a schematic of an example C2c2 based CRISPR effector system.
[0040] [0040] FIGs. 2A-2F – provide (FIG. 2A) schematics of the CRISPR/C2c2 locus of Leptotrichia wadei.
[0041] [0041] FIG. 3 - Shows detection of an example masking construct at different dilutions using 1 µg, 100 ng, 10 ng and 1 ng of target with 4 different amounts of protein/crRNA (1:4, 1:16, 1:32, 1:64) with 2 sets of crRNAs, no crRNA condition, technical duplicates, in (96+48)*2 = 288 reactions, measured at a 5-minute interval for 3 hours.
[0042] [0042] FIG. 4 - Shows detection of an example masking construct at different dilutions using 1 µg, 100 ng, 10 ng and 1 ng of target with 4 different amounts of protein/crRNA (1:4, 1:16, 1:32, 1:64) with 2 sets of crRNAs, no crRNA condition, technical duplicates, in (96+48)*2 = 288 reactions, measured at a 5-minute interval for 3 hours.
[0043] [0043] FIG. 5 - Shows detection of an example masking construct at different dilutions using 1 µg, 100 ng, 10 ng and 1 ng of target with 4 different amounts of protein/crRNA (1:4, 1:16, 1:32, 1:64) with 2 sets of crRNAs, no crRNA condition, technical duplicates, in (96+48)*2 = 288 reactions, measured at a 5-minute interval for 3 hours.
[0044] [0044] FIG. 6 - Shows detection of an example masking construct at different dilutions using 1 µg, 100 ng, 10 ng and 1 ng of target with 4 different amounts of protein/crRNA (1:4, 1:16, 1:32, 1:64) with 2 sets of crRNAs, no crRNA condition, technical duplicates, in (96+48)*2 = 288 reactions, measured at a 5-minute interval for 3 hours.
[0045] [0045] FIG. 7 - provides a schematic of an example detection scheme using a masking construct and CRISPR effector protein, according to certain example embodiments.
[0046] [0046] FIG. 8 - provides a set of graphs that show changes in fluorescence over time when detecting a target using different sets of guide RNAs.
[0047] [0047] FIG. 9 - provides a graph showing normalized fluorescence detected at different dilutions of target RNA at varying concentrations of CRISPR effector protein.
[0048] [0048] FIG. 10 - is a schematic showing the general steps of a NASBA amplification reaction.
[0049] [0049] FIG. 11 - provides a graph showing ssRNA1 detection of NASBA-amplified nucleic acid with three different primer sets and then subjected to collateral detection of C2c2 using a quenched fluorescent probe (n = 2 technical replicates; bars represent mean ± without).
[0050] [0050] FIG. 12 - provides a graph showing that the side effect can be used to detect the presence of a lentiviral target RNA.
[0051] [0051] FIG. 13 - provides a graph demonstrating that side effect and NASBA can detect species at concentrations aM.
[0052] [0052] FIG. 14 - provides a graph demonstrating that side effect and NASBA rapidly discriminate low concentration samples.
[0053] [0053] FIG. 15 - Shows that normalized fluorescence at certain times is predictive of the input sample concentration. Fluorescence measurements from Cas13a detection without amplification are correlated with the input RNA concentration. (n=2 biological replicates; bars represent mean ± without).
[0054] [0054] FIG. 16 - provides a schematic of the RPA reaction, showing the components participating in the reaction.
[0055] [0055] FIG. 17 - SHERLOCK scheme; provides a schematic showing detection of DNA or RNA targets via incorporation of an RPA or RT-RPA step accordingly. After recognition of the target RNA, the side effect causes C2c2 to cut the cleavage reporter, generating fluorescence. Single-molecule amounts of RNA or DNA can be amplified to DNA via recombinase polymerase (RPA) amplification and transcribed to produce RNA, which is then detected by C2c2.
[0056] [0056] FIG. 18 - provides a schematic of the ssRNA target detected by collateral detection of C2c2 (SEQ.
[0057] [0057] FIG. 19 - provides a set of graphs demonstrating detection of single molecule DNA using RPA (ie 15 minutes after the addition of C2c2).
[0058] [0058] FIG. 20 - provides a set of graphs demonstrating that mixing of T7 polymerase in an RPA reaction adversely affects DNA detection.
[0059] [0059] FIG. 21 - provides a set of graphs demonstrating that mixing the polymerase in an RPA reaction does not adversely affect DNA detection.
[0060] [0060] FIG. 22 - provides a graph demonstrating that RPA, T7 transcription, and C2c2 detection reactions are compatible and achieve single-molecule detection when incubated simultaneously (n = 2 technical replicates; bars represent mean ± s.e.m.).
[0061] [0061] FIG. 23 - provides a set of graphs demonstrating the effectiveness of rapid time incubations of RPA-RNA.
[0062] [0062] FIG. 24 - provides a set of graphs demonstrating that increasing the amount of T7 polymerase increases the sensitivity to RNA-RPA.
[0063] [0063] FIG. 25- provides a set of graphs showing the results of an RPA-DNA detection assay using a 1.5x one-pot enzyme reaction.Single molecule detection (2aM) achieved in 30 minutes.
[0064] [0064] FIG. 26 - provides a set of graphs demonstrating that an RPA-DNA potentiometer reaction demonstrates a quantitative decrease in fluorescence relative to the input concentration. The fitted curve reveals relationship between the target input concentration and the output fluorescence.
[0065] [0065] FIGs 27A, 27B - provide a set of graphs demonstrating that (FIG. 27A) C2c2 detection of RNA without amplification can detect the ssRNA target at concentrations below 50 fM. (n=2 technical replicates; bars represent mean ± s.e.m.), and that (FIG. 27B) the RPA-C2c2 reaction is capable of detecting single molecule DNA (n=4 technical replicates; bars represent mean ± s.e.m.).
[0066] [0066] FIG. 28 - provides a set of graphs demonstrating that a C2c2 signal generated according to certain exemplary embodiments can detect a 20 pM target on a paper substrate.
[0067] [0067] FIG. 29 - provides a graph showing that a specific RNAse inhibitor is a background signal removal cable on paper.
[0068] [0068] FIG. 30 is a set of graphs showing detection using systems in accordance with certain exemplary embodiments on fiberglass substrates.
[0069] [0069] FIGs. 31A-31D - provides a set of graphs providing (FIG. 31A) a schematic of Zika RNA detection according to certain example modalities. The lentivirus was packaged with Zika RNA or homologous fragments of dengue RNA, the target of collateral detection of C2c2. The medium is harvested after 48 hours and subjected to thermal lysis, RT-RPA and C2c2 detection. (FIG. 31B) Detection of RT-RAP-C2c2 is capable of highly sensitive detection of lentiviral Zika particles (n = 4 technical replicates, two-tailed Student's t test; *****, p <0.0001; bars represent mean ± wk) (FIG. 31C) A scheme of Zika RNA detection using lyophilized C2c2 on paper, according to certain exemplary embodiments. (FIG. 31D) The paper-based assay is capable of detecting highly sensitive Zika lentivirus particles (n-4 technical replicas, two-tailed Student's t test; ****, p<0.0001; **, p <0.01, bars represent mean ± wk).
[0070] [0070] FIGs. 32A, 32B - provide a set of graphs demonstrating (FIG. 32A) a scheme for the detection of C2c2 from Zika RNA isolated from human serum. Serum Zika ORNA undergoes reverse transcription, RNA RNase H degradation, cDNA RPA, and C2c2 detection. (FIG.
[0071] [0071] FIGs. 33A-33G - provide a set of graphs demonstrating that (Fig. 33A) lyophilized C2c2 is capable of sensitive detection of ssRNA1 in the low femtomolar range. C2c2 is capable of rapid detection of a ssRNA1200pM target on paper in liquid (FIG. 33B) or lyophilized (FIG. 33C) form. The reaction is capable of sensitive detection of Zika RNA fragments synthesized in solution (FIG. 33D) (n=3) and in lyophilized form (FIG. 33E) (n=3). (FIG. 33F) Quantitative curve for detection of human Zika cDNA showing significant correlation between input concentration and detected fluorescence. (FIG.
[0072] [0072] FIGs. 34A-34C - provide (FIG. 34A) the scheme of C2c2 detection of the 16S rRNA gene from bacterial genomes using a universal V3RPA primer set and the ability to achieve sensitive and specific detection of (FIG. 34B) E. coli GDNA or (FIG. 34C) P.
[0073] [0073] FIGs. 35A, 35B - provide a set of graphs demonstrating (FIG. 35A) the detection of two different carbapenem resistance genes (KPC and NDM-1) from four different clinical isolates of Klebsiella pneumoniae and (FIG. 35B) the detection of resistance to carbapenem (part A) is normalized as a signal ratio between KRPC and NDM-1 crRNA assays (n=2 technical replicates, two-tailed Student's t test; ****, p < 0.0001; bars represent mean ± without).
[0074] [0074] FIGs. 36A-36C - provide a set of graphs demonstrating that (FIG. 36A) C2c2 is not sensitive to single mismatches, but can distinguish between single nucleotide differences in the target when loaded with crRNAs with additional mismatches. ssRNA1-3 targets were detected with 11 crRNAs, with 10 spacers containing synthetic mismatches at various positions on the crRNA. The mismatched spacers did not show reduced cleavage of target 1, but showed inhibited cleavage of mismatch targets 2 and 3 (SEQ.IDs 5 to 18).(FIG.
[0075] [0075] FIGs. 37A-37D - provide a set of graphs demonstrating: (FIG. 37A) the layout of the Zika strain target regions and the crRNA sequences used for detection (SEQ. I.D. Nos. 24 to 29). SNPs in the target are highlighted in red or blue and synthetic mismatches in the guide sequence are colored in red.
[0076] [0076] FIGs. 38A-38D - provide a set of graphs showing (FIG. 38A) circuses plot showing the location of human SNPs detected with C2c2. (FIG. 38B) Assay performed according to certain exemplary embodiments can distinguish between human SNPs. OSHERLOCK can correctly genotype four different individuals at four different SNP sites in the human genome. The genotypes for each individual and the identities of allele-detecting crRNAs are noted below each graph (n=4 technical replicates; two-tailed Student's t test; *, p <0.05; **, p <0.01; ***, p <0.001; ****, p <0.0001; bars represent mean ± wk). (FIG. 38C) An outline of the process for detecting cfDNA (such as detecting cell-free DNA of cancer mutations) according to certain exemplary embodiments. (FIG. 38D) Example of crRNA sequences to detect EGFRL858R and BRAFV600E. (SEQ.I.D. Nos.
[0077] [0077] FIGs. 39A, 39B - provide a set of graphs demonstrating that C2c2 can detect the mutant minor allele in simulated cell-free DNA samples of the EGFRL858R (FG.39A) or the BRAFV600E minor allele (FIG. 39B) (n = 4 technical replicates, two-tailed Student's t test; *, p<0.05; **, p<0.01, ****, P<0.0001; bars represent ± sem).
[0078] [0078] FIGs. 40A, 40B - provide a set of graphs demonstrating that (FIG. 40A) the assay can distinguish between genotypes in rs5082 (n = 4 technical replicates; *, p<0.05; **, p<0.01; ** *, p <0.001; ** **, p <0.0001; bars represent mean ± wk). (FIG. 40B) the assay can distinguish between genotypes at rs601338 in gDNA directly from centrifuged, denatured, and boiled saliva (n = 3 technical repeats; *, p <0.05; bars represent mean ± s.e.m.).
[0079] [0079] FIGs. 41A, 41B - provide (FIG. 41A) a schematic of an example embodiment performed on ssDNA1 against the background of a target that differs from ssDNA1 by only a single mismatch. (FIG. 41B) The assay achieves detection of single nucleotide specificity of ssDNA1 in the presence of a background mismatch (target that differs only by a single ssDNA mismatch). Various concentrations of target DNA were combined with an excess of background DNA with a mismatch and detected by the assay.
[0080] [0080] FIG. 42 is a graph showing a masking construct with a different Cy5 dye also allows for effective detection.
[0081] [0081] FIG. 43 is a schematic of an assay based on colorimetry of gold nanoparticles. AuNPs are aggregated using a combination of DNA ligands and an RNA bridge. Upon addition of RNase activity, the ssRNA bridge is cleaved and AuNPs are released, causing a characteristic color change towards red.
[0082] [0082] FIG. 44 is a graph showing the ability to detect the change in color of the nanoparticles dispersed at 520 nm. The nanoparticles were based on the exemplary modality shown in Figure 43 and dispersed using the addition of RNase A at varying concentrations.
[0083] [0083] FIG. 45 is a graph showing that the RNase colorimetric test is quantitative.
[0084] [0084] FIG. 46 is an image of a microwell plate showing that the color change in the dispersed nanoparticle is visually detectable.
[0085] [0085] FIG. 47 is a figure demonstrating that colorimetric shift is visible on a paper substrate. The test was performed for 10 minutes at 37 degrees C on 934-AH fiberglass.
[0086] [0086] FIGs. 48A, 48B are schematics of (FIG. 48A) a conformational switch aptamer according to certain exemplary embodiments for detecting proteins or small molecules. Bound product (FIG. 48B) is used as a complete target for the RNA targeting effector, which cannot detect unbound input product (SEQ. I.D. Nos. 202 and 424).
[0087] [0087] FIG. 49 is an image of a gel showing that aptamer-based binding can create RPA-detectable substrates. Aptamers were incubated with various levels of thrombin and then probe ligated. Bound constructs were used as templates for a 3-minute RPA reaction .500 nM thrombin has significantly higher levels of amplified target than background.
[0088] [0088] FIG. 50 shows the amino acid sequence of the HEPN domains of selected C2c2 orthologs (SEQ.
[0089] [0089] FIG. 51 Cas13a RNA detection with RPA amplification (SHERLOCK) can detect the ssRNA target at concentrations up to ~2 aM, more sensitive than the ssRNA target.
[0090] [0090] FIGs. 52A, 52BA Cas13a detection can be used to detect viral and bacterial pathogens. (FIG.
[0091] [0091] FIG. 53 - Comparison of ssRNA1 detection by NASBA with primer set 2 (from Figure 11) and SHERLOCK (n = 2 technical replicates; bars represent mean ± s.e.m.).
[0092] [0092] FIGs. 54A-54C - Single reaction RPA and SHERLOCK nucleic acid amplification. (FIG. 54A) PCR quantification of ssRNA1 digital droplets for dilutions used in Fig. 1C. The adjusted concentrations for the dilutions based on the ddPCR results are shown above the bar graphs. (FIG. 54B) PCR quantification of ssDNA1 digital droplets for dilutions used in Fig. 1D. Adjusted concentrations for the dilutions based on the ddPCR results are shown above the bar graphs. (FIG. 54C) RPA, T7 and Cas13a transcription detection reactions are compatible and achieve detection of single-molecule DNA2 when incubated simultaneously (n=3 technical replicates, two-tailed Student's t test; ns, not significant; * *, p <0.01; ****, p <0.0001; bars represent mean ± wk).
[0093] [0093] FIGs. 55A-55D - Comparison of SHERLOCK with other sensitive nucleic acid detection tools. (FIG. 55A) Detection analysis of ssDNA1 dilution series with digital droplet PCR (n = 4 technical replicates, two-tailed Student's t test; ns, not significant; *, p<0.05; **, p< 0.01; ****, p < 0.0001; red lines represent mean, bars represent mean ± no Samples with measured copy/mL below 10-1 not shown.). (FIG. 55B) Detection analysis of ssDNA1 dilution series with quantitative PCR (n = 16 technical replicates, two-tailed Student's t test; ns, not significant; **, p < 0.01; ****, p <0.0001; red lines represent mean, bars represent mean ± no Samples with relative sign below 10-10 not shown). (FIG. 55C) Detection analysis of ssDNA1 dilution series with RPA with SYBRGreen II (n = 4 technical replicates, two-tailed Student's t test; *, p<0.05; **, p<0.01; the lines red represent means, bars represent mean ± no Samples with relative sign below 100 not shown.). (FIG. 55D) Detection analysis of ssDNA1 dilution series with SHERLOCK (n = 4 technical replicates, two-tailed Student's t test; **, p<0.01; ****, p<0.0001; the red lines represent mean, bars represent mean ± no Samples with relative sign below 100 not shown.). (FIG. 55E) Coefficient of percent variation for a series of ssDNA1 dilutions for four types of detection methods. (FIG. 55F) Average percent coefficient of variation for the 6e2, 6e1, 6e0 and 6e-1 ssDNA1 dilutions for four types of detection methods (bars represent mean ± wk).
[0094] [0094] FIG. 56 - Detection of carbapanem resistance in clinical bacterial isolates.Detection of two different carbapenem resistance genes (KPC and NDM-1) from five clinical isolates of Klebsiella pneumoniae and a control of E. coli (n=4 technical replicates, test Two-tailed Student's t; ****, p <0.0001; bars represent mean ± w/o; nd, not detected).
[0095] [0095] FIGs. 57A-57G - Characterization of LwCas13a sensitivity to truncated spacers and unique target sequence mismatches. (FIG. 57A) Sequences of truncated spacer crRNAs (SEQ.ID Nos. 72-83) used in (FIG. 57B-FIG. 57G). Also shown are sequences of ssRNA1 and 2, which have a single highlighted base pair difference. in red. crRNAs containing synthetic mismatches are displayed with mismatch positions colored red. (FIG. 57B) Collateral cleavage activity on ssRNA1 and 2 for the 28 nt spacer crRNA with synthetic mismatches at positions 1-7 (n=4 technical replicates; bars represent mean ± wk).
[0096] [0096] FIGs. 58A-58C - Identification of the optimal position of synthetic mismatch in relation to mutations in the target sequence. (FIG. 58A) Sequences for assessing the optimal position of synthetic mismatch to detect a mutation between ssRNA1 and ssRNA (SEQ. I.D. Nos. 84 – 115).
[0097] [0097] FIG. 59 - Genotyping with SHERLOCK at an additional locus and direct genotyping from boiled saliva two-tailed; **, p<0.01; ****, p<0.001; bars represent mean ± wk).
[0098] [0098] FIGs. 60A-60E - Development of synthetic genotyping standards for accurate genotyping of human SNPs. (FIG. 60A) SHERLOCK genotyping at SNP site rs601338 for each of the four subjects compared to PCR amplified genotype patterns (n=4 technical replicates; bars represent mean ± s.e.m.). (FIG. 60B) SHERLOCK genotyping at the rs4363657SNP site for each of the four subjects compared to PCR amplified genotype patterns (n = 4 technical replicates; bars represent mean ± s.e.m.). (FIG. 60C) Heat maps of the p-values computed between the SHERLOCK results for each individual and the synthetic patterns on the SNP website rs601338. A heat map is shown for each of the allele-detecting crRNAs. heatmap colors is scaled so that the trifle (p
[0099] [0099] FIG. 61 - Detection of ssDNA1 as a small fraction of mismatched background target.SHERLOCK detection of a dilution series of ssDNA1 in a human genomic DNA background.Note that there should be no sequence similarity between the ssDNA1 target being detected and the DNA genomic background (n=2 technical replicates; bars represent mean ± wk).
[00100] [00100] FIGs. 62A, 62B – The urine samples (FIG.
[00101] [00101] FIGs. 63A, 63B - Urine samples from patients with Zika virus were heat inactivated for 5 minutes at 95oC. One microliter of inactivated urine was used as input for a 30-minute RPA reaction followed by a 3 hour (FIG. 63A) or 1 hour (FIG. 63B) C2c2/Cas13 detection reaction, according to exemplary modalities. Error bars indicate 1SD based on n=4 technical replicates for the detection reaction.
[00102] [00102] FIG. 64 - Urine samples from patients with Zika virus were inactivated by 5 minutes at 95oC. One microliter of inactivated urine was used as input for a 20-minute RPA reaction followed by a 1-hour C2c2/Cas13a detection reaction. Healthy human urine was used as a negative control. Error bars indicate 1SD based on n = 4 technical replicates for the detection reaction.
[00103] [00103] FIGs. 65A, 65B - Urine samples from patients with Zika virus were inactivated by 5 minutes at 95oC. One microliter of inactivated urine was used as input for a 20-minute RPA reaction followed by a 1-hour C2c2/Cas13a detection reaction in the presence or absence of guide RNA. The data are shown in two different graphs and are normalized by subtracting the mean fluorescence values for non-guided detection reactions from the detection reactions that contain guides. Healthy human urine was used as a negative control. Error bars indicate 1SD based on n=4 technical replicas for the detection reaction.
[00104] [00104] FIG. 66 - Shows detection of two malaria-specific targets with four different lead RNA designs, according to example modalities. (SEQ.
[00105] [00105] FIGs. 67A, 67B – Provides graphs showing the editing preferences of different Cas13b orthologs.
[00106] [00106] FIG. 68 - provides A) a schematic of a multiplex assay using different Cas13b orthologs with different editing preferences and B) data demonstrating the feasibility of an assay using Cas13b10 and Cas13b5.
[00107] [00107] FIG. 69 - provides graphs showing double multiplexing with Cas13b5 (Prevotella sp.Orthologs MA2106) and Cas13b9 (Prevotella intermedia). Effector proteins and guide sequences were contained in the same reaction, allowing double multiplexing in the same reaction, using different reads fluorescent (poly U530 nm and poly A485 nm).
[00108] [00108] FIG. 70 - provides the same as in FIG. 69 but in this case using Cas13a orthologs (Leptorichia wadei LwaCas13a) and Cas13b orthologs (Prevotella sp. MA2016, Cas13b5).
[00109] [00109] FIG. 71 - provides a method for grouping target sequences with various guide sequences in order to determine targeting robustness, in accordance with certain example embodiments (SEQ. I.D. Nos. 128 and 129).
[00110] [00110] FIG. 72 - provides hybrid chain reaction (HCR) gels showing that Cas13 effector proteins can be used to unlock a primer, e.g. a primer embedded in a masking construct, as described here, to activate a hybridization chain reaction .
[00111] [00111] FIG. 73 - provides data showing the ability to detect Pseudomonas aeruginosa in complex lysate.
[00112] [00112] FIG. 74 - provides data showing ion preferences of certain Cas13 orthologs according to certain example modalities. All target concentrations were 20 nM input with ion concentrations of (1mM and 10mM).
[00113] [00113] FIG. 75 - provides data showing that Cas13b12 has a preference for 1mM zinc sulfate for cleavage.
[00114] [00114] FIG. 76 - provides data showing that buffer optimization can increase the Cas13b5 signal to noise in a polyA reporter. The old buffer comprises 40 mM Tris-HCL, 60 mM NaCl, 26 mM MgCl2, pH7.3. The new buffer comprises 20 mM HEPES, pH6.8, 60 mM MgCl26 and 60 mM NaCl.
[00115] [00115] FIG. 77 - provides a schematic of TypeVI-A/CCrispr systems and Type VI-B1 and B2 systems, as well as a phylogenetic tree of representative Cas13b orthologs.
[00116] [00116] FIG. 78 - provides relative cleavage activity at different nucleotides of various orthologs of Cas13b and in relation to an LwCas13a.
[00117] [00117] FIG. 79 - provides a graph showing the relative sensitivity of various examples of Cas13 orthologs.
[00118] [00118] FIG. 80 - provides graph showing the ability to achieve molar zepto (zM) detection levels using an example modality.
[00119] [00119] FIGs. 81A-81D – provides the schematic of a multiplex assay using Cas13 orthologs with different editing preferences and polyN-based masking constructs.
[00120] [00120] FIGs. 82A-82F - provides data showing the results of primer optimization experiments and detection of pseudomonas under a variety of conditions.
[00121] [00121] FIGs. 83A-83H – illustrates the biochemical characterization of the Cas13b family of RNA-targeting enzymes guided by quantitative and increased sensitivity SHERLOCK and RNA. (FIG. 83A) Schematic of the structure of the CRISPR-Cas13 loci and the structure of crRNA. (FIG. 83B) A base preference heat map of 15 Cas13b orthologs targeting ssRNA1 with sensor probes consisting of a hexamer homopolymer of bases A, C, G or U. (FIG. 83C) Schematic of the discovery preference screen of cleavage motifs and preferred two-base motifs for LwaCas13a and PsmCas13b. The values represented in the heat map are the counts of every two bases in all exhausted motifs. Motifs are considered exhausted if o -log2(target/non-target) is above 1.0 in the LwaCas13a condition or 0.5 in the PsmCas13b condition. In the -log2(target/non-target) value, target and non-target denote the frequency of a motif under target and non-target conditions, respectively. (FIG. 83D) Orthogonal background preferences of PsmCas13b and LwaCas13a targeting ssRNA1 with a U6 or A6 sensor probe. (FIG. 83E) Single-molecule SHERLOCK detection with LwaCas13a and PsmCas13b targeting the dengue ssRNA target. (FIG. 83F) Single-molecule SHERLOCK detection with LwaCas13a and PsmCas13b in large reaction volumes to increase ssRNA target 1-targeted sensitivity.
[00122] [00122] FIGs. 84A-84H – illustrates SHERLOCK sample multiplexing with orthogonal Cas13 enzymes.
[00123] [00123] FIG. 85 - provides a tree of 15 Cas13b orthologs purified and evaluated for collateral activity in vitro. Cas13b gene (blue), Csx27/Csx28 gene (red/yellow), and CRISPR matrix (grey) are shown.
[00124] [00124] FIGs. 86A-86C– illustrates protein purification from Cas13 orthologs. (FIG. 86A) Size exclusion chromatography chromatograms for Cas13b, LwCas13a and LbaCas13a used in this study. The measured UV absorbance (mAU) is shown against the elution volume (ml). (FIG. 86B) SDS-PAGE Gel of purified Cas13b orthologs. Fourteen Cas13b orthologs are loaded from left to right. A protein ladder is shown on the left. (FIG.
[00125] [00125] FIGs. 87A-87D – shows graphs illustrating the basic preference of collateral cleavage with Cas13b ortholog. (FIG. 87A) Cleavage activity of fourteen Cas13b orthologs targeting ssRNA1 using a six nucleotide adenine homopolymer sensor. (FIG. 87B) Cleavage activity of fourteen Cas13b orthologs targeting ssRNA1 using a six nucleotide uridine homopolymer sensor. (FIG. 87C) Cleavage activity of fourteen Cas13b orthologs targeting ssRNA1 using a six nucleotide guanine homopolymer sensor. (FIG. 87D) Cleavage activity of fourteen Cas13b orthologs targeting ssRNA1 using a six nucleotide cytidine homopolymer sensor.
[00126] [00126] FIG. 88 - shows analysis of random motif library size after collateral cleavage of Cas13. Bioanalyzer traces for samples from libraries treated with LwaCas13a-, PsmCas13b-, CcaCas13b- and RNase A showing changes in library size following RNase activity.Cas13 orthologs target Dengue ssRNA and cleave the library at random due to to collateral cleavage. Marker patterns are shown in the first track.
[00127] [00127] FIGs. 89A-89D – shows a representation of various motifs after cleavage by RNases. (FIG. 89A) Box plots showing the distribution of target to non-target ratios for LwaCas13a, PsmCas13b, CcaCas13b and RNase A at 5 and 60 minute time points. RNase A ratios were compared to the mean of the three targetless conditions of Cas13. The ratios are also an average of two repeats of the cleavage reaction. (FIG. 89B) Number of motifs enriched for LwaCas13a, PsmCas13b, CcaCas13b, and RNase A at the 60 minute time point. The reason for enrichment was calculated as above - log2(target/on target) of 1 (LwaCas13a, CcaCas13b and RNase A) or 0.5 (PsmCas13b). A threshold of 1 corresponds to at least 50% exhaustion, while a threshold of 0.5 corresponds to at least 30% exhaustion. (FIG. 89C) Sequence logos generated from enriched motifs for LwaCas13a, PsmCas13b and CcaCas13b.LwaCas13a and CcaCas13b show a strong preference for U as would be expected, while PsmCas13b shows a unique preference of A bases in the motif, which is consistent and with the collateral activity preferences of the homopolymer. (FIG. 89D) Heat map showing the orthogonal motif preferences of LwaCas13a, PsmCas13b and CcaCas13b. The values represented in the heat map are the -log2(target/non-target) value of each motif shown. In the -log2(target/non-target) value, target and non-target denote the frequency of a motif under target and non-target conditions, respectively.
[00128] [00128] FIGs. 90A-90C – shows single-base and two-base preferences of RNases determined by the random motif library screen. (FIG. 90A) Heat maps showing single dibase preferences for LwaCas13a, PsmCas13b, CcaCas13b and RNase A in the 60 minute time period as determined by the motif library random cleavage screen. The values represented in the heat map are the each base counts on all exhausted grounds. Motifs are considered exhausted if the -log2 (target/non-target) value is above 1.0 in the LwaCas13a, CcaCas13b and RNase A conditions or 0.5 in the PsmCas13b condition. In the -log2(target/non-target) value, target and non-target denote the frequency of a motif under target and non-target conditions, respectively. (FIG. 90B) Heat maps showing two-base preference for CcaCas13b as determined by the random motif library cleavage screen. The values represented in the heatmap are the counts of every 2-bases in all exhausted grounds.
[00129] [00129] FIG. 91 - illustrates preferences of three RNase bases determined by random motif library screen. The heat maps show three base preferences for LwaCas13a, PsmCas13b, CcaCas13b and RNase A in the 60 minute time period as determined by the motif library random cleavage screen. The values represented in the heatmap are the counts of every 3-bases in all exhausted grounds. Motifs are considered exhausted if the -log2 (target/non-target) value is above 1.0 in the LwaCas13a, CcaCas13b and RNase A conditions or 0.5 in the PsmCas13b condition. In the -log2(target/non-target) value, target and non-target denote the frequency of a motif under target and non-target conditions, respectively.
[00130] [00130] FIGs. 92A-92D - illustrate four base preferences of RNases determined by random motif library screen. The heat maps show four base preferences for LwaCas13a, PsmCas13b, CcaCas13b, and RNase A in the 60 minute time period as determined by the motif library random cleavage screen. The values represented in the heatmap are the counts of every 4-bases in all exhausted grounds. Motifs are considered exhausted if the value -
[00131] [00131] FIGs. 93A-93C - shows results of Cas13 ortholog base cleavage preference tests with in vitro cleavage of poly-X substrates. (FIG. 93A) In vitro cleavage of poly-U, C, G and A targets with LwaCas13a incubated with and without crRNA. (FIG. 93B) In vitro cleavage of poly-U, C, G and A targets with CcaCas13b incubated with and without crRNA. (FIG. 93C) In vitro cleavage of poly-U, C, G and A targets with PsmCas13a incubated with and without crRNA.
[00132] [00132] FIGs. 94A, 94B - shows results of buffer optimization of PsmCas13b cleavage activity.
[00133] [00133] FIGs. 95A-95F - illustrates the ion preference of Cas13 orthologs for collateral cleavage. (FIG.
[00134] [00134] FIGs. 96A, 96B – shows comparison of cleavage activity for Cas13 orthologs with adenine cleavage preference. (FIG. 96A) Cleavage activity of PsmCas13b and LbaCas13a incubated with the respective crRNAs targeting a synthetic Zika target at different concentrations (n=4 technical replicates, two-tailed Student's t test; ns, not significant; *, p < 0, 05; **, p <0.01; ***, p <0.001; ****, p <0.0001; bars represent mean ± wk). (FIG. 96B) Cleavage activity of PsmCas13b and LbaCas13a incubated with the respective crRNAs targeting a synthetic Dengue target at different concentrations (n=4 technical replicates, two-tailed Student's t test; ns, not significant; *, p < 0, 05; **, p <0.01; ***, p <0.001; ****, p <0.0001; bars represent mean ± wk).
[00135] [00135] FIGs. 97A, 97B - illustrate atomole detection of Zika ssRNA target 4 with SHERLOCK with LwaCas13a and PsmCas13b. (FIG. 97A) SHERLOCK detection of Zika ssRNA at different concentrations with LwaCas13a and poly U sensor. (FIG. 97B) SHERLOCK detection of Zika ssRNA at different concentrations with PsmCas13b and poly A sensor.
[00136] [00136] FIG. 98 - illustrates the atomole detection of Dengue ssRNA with SHERLOCK at different concentrations of CcaCas13b.
[00137] [00137] FIGs. 99A, 99B - testing the reprogrammability of the Cas13 ortholog with crRNAs side-by-side with ssRNA1. (FIG. 99A) Cleavage activity of LwaCas13a and CcaCas13b with side-by-side crRNAs via ssRNA1. (FIG.
[00138] [00138] FIGs. 100A, 100B - show the effect of crRNA spacer length on cleavage of the Cas13 ortholog. (FIG. 100A) Cleavage activity of PsmCas13b with crRNAs targeting ssRNA1 of varying spacer lengths. (FIG. 100B) Cleavage activity of CcaCas13b with crRNAs targeting ssRNA1 of varying spacer lengths.
[00139] [00139] FIGs. 101A-101G - illustrate primer concentration optimization for quantitative SHERLOCK. (FIG.
[00140] [00140] FIGs. 102A-102C - illustrate multiplexed detection of Zika and Dengue targets. (FIG. 102A) Multiplexed two-color detection using LwaCas13a targeting a Zika ssRNA target and PsmCas13b targeting a dengue ssRNA target. Both targets are at the 20nM input. All data shown represents 180 minutes at the reaction point. (FIG. 102B) Multiplexed two-color detection using LwaCas13a targeting a Zika ssRNA target and PsmCas13b targeting a Dengue ssRNA target. Both targets are at the 200pM input. (FIG. 102C) Multiplexed detection in a 20 pM synthetic RNA sample of Zika and Dengue with collateral activity of CcaCas13a and PsmCas13b.
[00141] [00141] FIGs. 103A, 103B - illustrate detection of multiplexed RNA in Zika and Dengue ssRNA sample. Sample multiplexed RPA and collateral detection at decreasing concentrations of Zika and Dengue synthetic targets with PsmCas13b and CcaCas13b.
[00142] [00142] FIGs. 104A, 104B - illustrate non-multiplexed theranostic detection of mutations and REPAIR editing.
[00143] [00143] FIGs. 105A-105E - illustrate colorimetric detection of RNase activity with gold nanoparticle aggregation. (FIG. 105A) Colorimetric readout scheme based on gold nanoparticles for RNase activity. In the absence of RNase activity, RNA ligands aggregate gold nanoparticles, leading to loss of red color. Cleavage of RNA ligands releases nanoparticles and results in a red color change. (FIG. 105B) Image of colorimetric reporters after 120 minutes of RNase digestion of several RNase A units. (FIG. 105C) Kinetics at 520nm absorbance of AuNP colorimetric reporters with digestion in various unit concentrations of RNase A. (FIG. 105D) The 520 nm absorbance of AuNP colorimetric reporters after 120 minutes of digestion at various unit concentrations of RNase A. (FIG. 105E) Time to reach half the maximum A520 of AuNP colorimetric reporters with digestion at various unit concentrations of RNase A.
[00144] [00144] FIGs. 106A-106C - illustrates the quantitative detection of the CP4-EPSPS gene from soybean genomic DNA. (FIG. 106A) The mean R2 correlation of the SHERLOCK background subtracted the fluorescence and the percentage of CP4-EPSPS beans at different detection time points. The percentage of beans represents the amount of beans ready for rounding in a mixture of beans ready for rounding. roundness and wild-type. The CP4-EPSPS gene is present only in beans ready for processing. (FIG. 106B) SHERLOCK detection of the CP4-EPSPS resistance gene in different percentages of beans, showing the quantitative nature of SHERLOCK detection at 30 minutes of incubation.(FIG. 106C) SHERLOCK detection of the lectin gene in different percentages of beans. The percentage of beans represents the amount of ready-to-round beans in a mixture of ready-to-round and wild-type beans.The lectin gene is present in both types of beans and, therefore, does not show a correlation with the percentage of beans ready for preparation.
[00145] [00145] FIG. 107- illustrates the ability of Cpf1, with RPA, to detect up to 2aM DNA. ORPA amplifies DNA that is directly detected by AsCpf1 without the need for an additional T7 transcription step.
[00146] [00146] FIG. 108 - illustrates the three-color multiplexing enabled with Cpf1 due to its orthogonal cleavage.
[00147] [00147] FIG. 109 - illustrates a significance test performed on a three-color multiplex for all conditions against water/water/water control.
[00148] [00148] FIG. 110 - illustrates aptamer color generation.
[00149] [00149] FIG. 111 - illustrates aptamer design and concentration optimization (SEQIDNOS:130 and 131).
[00150] [00150] FIG. 112 - illustrates absorbance data for colorimetric detection.
[00151] [00151] FIG. 113 - illustrates the stability of colorimetric change.
[00152] [00152] FIG. 114 - illustrates comparison of colorimetric detection with fluorescence detection of Zika ssRNA.
[00153] [00153] FIG. 115 - illustrates an embodiment of the invention with Cpf1 as the nickase.
[00154] [00154] FIG. 116 - illustrates sample multiplexing with ortholog base preferences.
[00155] [00155] FIG. 117 - illustrates 3-plex in the sample with single-base orthological-based preferences and AsCpf1.
[00156] [00156] FIG. 118 - illustrates 4-plex in the sample with orthological-based dual-base preferences and AsCpf1.
[00157] [00157] FIGs. 119A-119F - illustrate the basic preference of Cas13 ortholog collateral cleavage. (FIG.
[00158] [00158] FIGs. 120A, 120B - Buffer optimization of PsmCas13b cleavage activity. (FIG. 120A) A variety of buffers are tested for their effects on PsmCas13b collateral activity after targeting to ssRNA1. (FIG. 120B) The optimized buffer is compared to the original buffer at different concentrations of the PsmCas13bcrRNA complex.
[00159] [00159] FIGs. 121A-121F – ion preference of Cas13 orthologs for collateral cleavage. (FIG. 121A) Cleavage activity of PsmCas13b with a fluorescent poly U sensor for divalent cations Ca, Co, Cu, Mg, Mn, Ni and Zn. PsmCas13b is incubated with a crRNA targeting a synthetic ssRNA 1. (FIG. 121B) Cleavage activity of PsmCas13b with a fluorescent poly A sensor for divalent cations Ca, Co, Cu, Mg, Mn, Ni and Zn. OPsmCas13b is incubated with a crRNA targeting a synthetic ssRNA 1.
[00160] [00160] FIGs. 122A-122C - testing the reprogrammability of the Cas13 ortholog with crRNAs side by side of ssRNA1. (FIG. 122A) Schematic of side-by-side crRNA sites targeting ssRNA1 (SEQIDNO: 132). (FIG. 122B) Cleavage activity of LwaCas13a and CcaCas13b with side-by-side crRNAs via ssRNA1. (FIG. 122C) Cleavage activity of PsmCas13b with side-by-side crRNAs via ssRNA1.
[00161] [00161] FIGs. 123A, 123B – Effect of crRNA spacer length on Cas13 ortholog cleavage. (FIG.
[00162] [00162] FIGs. 124A, 124B – Shows comparison of cleavage activity for Cas13 orthologs with adenine cleavage preference. (FIG. 124A) Cleavage activity of PsmCas13b and LbaCas13a incubated with the respective crRNAs targeting the ZIKV ssRNA at different concentrations (n=4 technical replicates, two-tailed Student's t test; ns, not significant; *, p < 0 .05; **, p <0.01; ***, p <0.001; ****, p <0.0001; bars represent mean ± wk). (FIG. 124B) Cleavage activity of PsmCas13b and LbaCas13a incubated with the respective crRNAs targeting a synthetic DENV ssRNA target at different concentrations (n=4 technical replicates, two-tailed Student's t test; ns, not significant; *, p < 0.05; **, p <0.01; ***, p <0.001; ****, p <0.0001; bars represent mean ± wk).
[00163] [00163] FIGs. 125A-125H - Multiplexed SHERLOCK detection with orthogonal collateral activity of Class 2 enzymes. (FIG. 125A) Scheme of the assay to determine the dinucleotide preferences of Cas13a/b enzymes.
[00164] [00164] FIGs. 126A-126D – Dinucleotide preferences of Cas13a/b enzymes. (FIG. 126A) Base preference heat map of 10Cas13a/b orthologs targeting ssRNA1, unless otherwise noted, with reporters consisting of a dinucleotide of RNAA, C, G, or U bases. (*) represent subtracted orthologs with no background and high background activity. (FIG. 126B) Nucleotide base preference heat map of high background orthologs LbuCas13a and PinCas13b tested on indicated targets. (FIG. 126C) The cleavage activity of LbuCas13a on the AU dinucleotide motif with and without a target of 20nM DENV ssRNA tested with varying spacer lengths. (FIG. 126D) The cleavage activity of LbuCas13a on the UG dinucleotide motif with and no DENV ssRNA 20nM target tested with varying spacer lengths.
[00165] [00165] FIGs. 127A-127C – Relation of Cas13 families with preferences for cleavage by dinucleotides. (FIG.
[00166] [00166] FIGs. 128A, 128B – Kinetics of cleavage activity for Cas13 enzymes with orthogonal cleavage preferences. (FIG. 128A) Orthogonal background preferences of PsmCas13b and LwaCas13a targeting ssRNA1 with a U6 or A6 reporter. (FIG. 128B) Orthogonal base preferences of CcaCas13b and LwaCas13a targeting DENV RNA with an AU or UC reporter.
[00167] [00167] FIGs. 129A-129E – Random motive cleavage screen for testing Cas13 base preferences. (FIG.
[00168] [00168] FIGs. 130A-130C – Motifs and orthogonal sequences of the random pattern cleavage screen. (FIG.
[00169] [00169] FIGs. 131A-131C – Comparison of primary collateral activity motifs from RNA motif collateral activity screens. (FIG. 131A) Heat map showing the orthogonal motif preferences of LwaCas13a, PsmCas13b and CcaCas13b. The values represented in the heat map are the -log2(target/non-target) value of each reason shown. In the -log2(target/non-target) value, target and non-target denote the frequency of a motif under target and non-target conditions, respectively. (FIG. 131B) Cleavage activity of LwaCas13a and CcaCas13b in upper orthogonal motifs derived from the motif preference discovery screen (FIG. 131C) Collateral activity of LwaCas13a and CcaCas13b targeting DENV ssRNA in upper orthogonal RNA motifs.
[00170] [00170] FIGs. 132A-132D – Screen comparison of random motif library on different targets and enzymes. (FIG. 132A) Pairwise comparison of enrichment scores for different activation targets with LwaCas13a. (FIG. 132B) Thermal maps showing two-base preference for LwaCas13a with the ZIKV ssRNA target, as determined by the library cleavage screen of random reasons. The values represented in the heatmap are the counts of every 2-bases in all exhausted grounds. Reasons are considered exhausted if the -log2(target/non-target) is above 1.0. (FIG. 132C) Heat maps showing two-base preference for LwaCas13a with the DENV ssRNA target, as determined by the random motif library cleavage screen. The values represented in the heat map are the counts of every 2-bases in all exhausted grounds. Reasons are considered exhausted if the -log2(target/non-target) is above 1.0. (FIG. 132D) Heat maps showing two-base preference for LwaCas13a with the ssRNA1 target, as determined by the random motif library cleavage screen. The values represented in the heatmap are the counts of every 2-bases in all exhausted grounds. Reasons are considered exhausted if the -log2(target/non-target) is above 1.0.
[00171] [00171] FIGs. 133A, 133B – Multiplexed detection of ZIKV ssRNA and DENV ssRNA targets. (FIG. 133A) Multiplexed detection in sample of 20 nM targets of ZIKV and DENV ssRNA with collateral activity of LwaCas13a and PsmCas13b.
[00172] [00172] FIG. 134 - CcaCas13b-SHERLOCK atomole detection. Comparison of collateral and collateral enhanced pre-amplification (SHERLOCK) activity of CcaCas13b.
[00173] [00173] FIGs. 135A, 135B – Triplex detection using orthogonal CRISPR enzymes. (FIG. 135A) Schematic of 3-channel multiplexing in the sample using orthogonal Cas13 and Cas12a enzymes. (FIG. 135B) Multiplexed detection in sample of ZIKV ssRNA, DENV ssRNA and dsDNA1 with LwaCas13a, PsmCas13b and Cas12a.
[00174] [00174] FIGs. 136A-136D - Detection of multiplexed RNA in a sample of ZIKV ssRNA and DENV ssRNA targets and human genotyping. (FIG. 136A) Sample multiplexed RPA and collateral detection at decreasing concentrations of ZIKV and DENV ssRNA targets with PsmCas13b. (FIG. 136B) Sample multiplexed RPA and collateral detection at decreasing concentrations of ZIKV and DENV ssRNA targets with LwaCas13a. (FIG. 136C) Schematic diagram of crRNA design and target sequences for multiplexed genotyping at rs601338 with LwaCas13a and PsmCas13b (SEQIDNO:134-137).(FIG.
[00175] [00175] FIGs. 137A-137G - Single molecule quantification and enhanced signal with SHERLOCK and Csm6 (FIG. 137A) Schematic of DNA reaction scheme for quantification of synthetic P. aeroginosa DNA. (FIG. 137B) Quantification of P. aeroginosa synthetic DNA at various concentrations of RPA primers. Values represent mean +/– S.E.M. (FIG. 137C) Correlation of P. aeroginosa synthetic DNA concentration with detected fluorescence.
[00176] [00176] FIGs. 138A-138G - Primer concentration optimization for quantitative SHERLOCK. (FIG. 138A) SHERLOCK kinetic curves of LwaCas13a incubated with ZIKV ssRNA targets of different concentrations and a crRNA complementary to an RPA primer concentration of
[00177] [00177] FIGs. 139A-139C - Large volume SHERLOCK reactions with subatomolar sensitivity (FIG. 139A) Scheme of large reactions for single molecule detection of increased sensitivity. (FIG. 139B) Single-molecule SHERLOCK detection with LwaCas13a in large reaction volumes to increase ssRNA target 1-targeted sensitivity. For reaction volumes of 250µL, 100µL of sample input is used, and for reaction volumes of 1000µL, 540µL of sample input is used. (FIG. 139C) Detection of single-molecule SHERLOCK with PsmCas13b in large reaction volumes to increase the target 1-targeted sensitivity of the ssRNA. For reaction volumes of 250 µL, 100 µL sample input is used.
[00178] [00178] FIGs. 140A-140F - Combination therapy 363 and diagnostics with Cas13 enzymes. (FIG. 140A) Timeline scheme for detection of disease alleles, correction with REPAIR, and assessment of REPAIR correction. (FIG. 140B) Target sequences and crRNA designs used for detection of APC alleles (SEQIDNO:138-141). (FIG. 140C) Target design and REPAIR guide sequences used for correction of APC alleles (SEQIDNO: 142 and 143).(FIG. 140D) Multiplexed detection in sample of APC alleles from healthy and disease-mimicking samples with LwaCas13a and
[00179] [00179] FIGs. 141A, 141B - Non-multiplexed theranostic detection of mutations and REPAIR editing. (FIG. 141A) Detection of APC alleles from healthy and diseased mock samples with LwaCas13a. (FIG. 141B) Detection with LwaCas13a of editing correction in APC alleles from REPAIR-targeted and non-REPAIR-targeted samples.
[00180] [00180] FIGs. 142A and 142B - Show lateral flow assay results for Dengue RNA and ssRNA1 using a Cas13b10 probe for dengue and a LwaCas13a probe for ssRNA1.
[00181] [00181] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by an individual moderately skilled in the art to which the present disclosure pertains. Definitions of terms and techniques common in molecular biology can be found in Molecular Cloning: ALaboratory Manual, 2nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: ALaboratory Manual, 4th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F.M. Ausubel et al.
[00182] [00182] As used in this document, the singular forms "a", "a", and "the" include the referent plural forms, unless the context clearly indicates otherwise.
[00183] [00183] The term "optional" or "optionally" means that the event or circumstance described later may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[00184] [00184] Recitation of numeric ranges by endpoints includes all numbers and fractions included in the respective ranges, as well as the recited endpoints.
[00185] [00185] The terms "about" or "approximately", as used herein, when referring to a measurable value, such as a parameter, a quantity, a time duration and the like, are intended to cover variations to and from the value specified, as variations of +/-10% or less, +/-5% or less, +/-1% or less and +/-0.1% or less of and from the specified value, to the extent such variations are appropriate to perform in the disclosed invention. It should be understood that the value to which the modifier "approximately" or "approximately" refers is also specifically and preferably disclosed.
[00186] [00186] Reference throughout this specification to "a modality", "certain modalities", "one or more modalities" or "a modality" means that a particular feature, structure, material or characteristic described in connection with the modality is included in at least one embodiment of the invention. Thus, the appearances of the phrases “in a modality” or “in a modality” in various places throughout this report are not necessarily all referring to the same modality. In addition, specific features, structures or characteristics may be appropriately combined in a or more embodiments. Furthermore, while some embodiments described herein include some, but not others, features included in other embodiments, combinations of features from different embodiments should be within the scope of the invention. For example, in the appended claims, any of the embodiments claimed may be used in any combination.
[00187] [00187] "C2c2" is now referred to as "Cas13a" and the terms are used interchangeably here unless otherwise noted.
[00188] [00188] All publications, published patent documents and patent applications cited herein are incorporated herein by reference to the same extent as if each publication, published patent document or individual patent application were specifically and individually indicated to be incorporated by reference .
[00189] [00189] CRISPR-associated adaptive immune systems (CRISPR-Cas) contain programmable endonucleases such as Cas9 and Cpf1 (Shmakov et al., 2017; Zetsche et al., 2015). Although both Cas9 and Cpf1 target DNA, effector RNA-guided RNases have recently been discovered (Shmakov et al., 2015) and characterized (Abudayyeh et al., 2016; Smargon et al., 2017), including C2c2, providing a platform for RNA-specific detection.RNA-guided RNases can be easily and conveniently reprogrammed using RNACRISPR (crRNAs) to cleave the target RNAs.Unlike DNACas9 and Cpf1 endonucleases, which cleave only their target DNA, RNAs such as Cas13a and Cpf1 remain active after cleavage of their RNA or DNA target, leading to "collateral" cleavage of non-target RNAs nearby (Abudayyeh et al., 2016).This programmed collateral RNA cleavage activity by crRNA presents the opportunity to use RNA-guided RNases to detect the presence of a specific RNA, triggering in vivo programmed cell death or in vitro nonspecific degradation of RNA that can serve as a readout (Abudayyeh et al., 2016; E ast-Seletsky et al., 2016).
[00190] [00190] The modalities disclosed herein utilize RNA targeting effectors to provide a robust CRISPR-based diagnosis with atomole sensitivity. The modalities disclosed herein can detect broth DNA and RNA with comparable levels of sensitivity and can differentiate targets from non-targets based on single base pair differences. In addition, the modalities disclosed in this document can be prepared in lyophilized format for convenient distribution and point-of-care (POC) applications. Such modalities are useful in various human health scenarios, including, for example, viral detection, bacterial strain typing , sensitive genotyping, and detection of disease-associated cell-free DNA. For ease of reference, the modalities disclosed herein may also be referred to as SHERLOCK (High Sensitivity Specific Enzyme Reporter Unlocker).
[00191] [00191] In one aspect, the embodiments disclosed herein are directed to a nucleic acid detection system comprising two or more CRISPR systems, one or more guide RNAs designed to bind to corresponding target molecules, a masking construct, and detection reagents. optional amplification to amplify target nucleic acid molecules in a sample.
[00192] [00192] In another aspect, the modalities disclosed herein are directed to a diagnostic device comprising a plurality of individual discrete volumes. Each individual discrete volume comprises a CRISPR effector protein, one or more guide RNAs designed to bind to a target molecule corresponding and a masking construct. In certain exemplary embodiments, RNA amplification reagents may be preloaded into individual discrete volumes or added to individual discrete volumes simultaneously or subsequent to the addition of a sample to each individual discrete volume. The device may be a microfluidic based device, a wearable device or device comprising a substrate of flexible material on which individual discrete volumes are defined.
[00193] [00193] In another aspect, the modalities disclosed herein are directed to a method for detecting target nucleic acids in a sample which comprises dispensing a sample or set of samples into a set of individual discrete volumes, each individual discrete volume comprising an effector protein CRISPR, one or more guide RNAs designed to bind to a target oligonucleotide and a masking construct. The sample pool is then maintained under conditions sufficient to allow binding of one or more guide RNAs to one or more target molecules. binding of one or more guide RNAs to a target nucleic acid, in turn, activates the CRISPR effector protein. Once activated, the CRISPR effector protein deactivates the masking construct, for example, cleaving the masking construct so that a signal detectable positive signal is unmasked, released, or generated.The detection of the detectable positive signal in an individual discrete volume indicates the presence of the molecules them target.
[00194] [00194] In yet another aspect, the modalities disclosed herein are directed to a method for detecting polypeptides. The method for detecting polypeptides is similar to the method for detecting target nucleic acids described above. However, a peptide detection aptamer is also included. .Peptide detection aptamers function as described above and facilitate the generation of a trigger oligonucleotide upon binding to a target polypeptide.Guide RNAs are designed to recognize trigger oligonucleotides, thereby activating the CRISPR effector protein. masking by the activated CRISPR effector protein leads to unmasking, release or generation of a detectable positive signal. NUCLEIC ACID DETECTION SYSTEMS
[00195] [00195] In some embodiments, the invention provides a nucleic acid detection system comprising i) two or more CRISPR systems, each CRISPR system comprising a Cas protein and a leader molecule comprising a leader sequence capable of binding to a corresponding target molecule and designed to form a complex with the Cas protein; and ii) a set of detection constructs, each detection construct comprising a cut motif sequence that is preferentially cut by one of the activated CRISPR effector proteins.
[00196] [00196] In general, a CRISPR-Cas or CRISPR system as used here and in documents such as WO2014/093622
[00197] [00197] In certain embodiments, a protospacer adjacent motif (PAM) or PAM-like motif directs the binding of the effector protein complex, as disclosed herein, to the target site of interest. In some embodiments, the PAM may be a PAM5 ' (that is, located upstream of the 5' end of the protospacer). In other embodiments, the PAM may be a PAM3' (that is, located downstream of the 5' end of the protospacer). The term "PAM" may be used interchangeably with the term "PFS" or "protospacer flank site" or "protospacer flank sequence".
[00198] [00198] In a preferred embodiment, the CRISPR effector protein may recognize a PAM3'. In certain embodiments, the CRISPR effector protein may recognize a PAM3' that is 5'H, where H is A, C, or U. In certain embodiments, the effective protein may be Leptotrichia shahii C2c2p, more preferably Leptotrichia shahii
[00199] [00199] In the context of forming a CRISPR complex, "target molecule or "target sequence" refers to a molecule that harbors a sequence, or a sequence in which a lead sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term "target RNA" refers to an RNA polynucleotide that is or comprises the target sequence. In other words, the target RNA can be an RNA polynucleotide or a part of an RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the effective function is mediated by the complex comprising the CRISPR effector protein and a gRNA it must be targeted. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. A target sequence may comprise DNA polynucleotides.
[00200] [00200] As such, a CRISPR system may comprise RNA-targeted effector proteins. A CRISPR system may comprise DNA-targeted effector proteins. In some embodiments, a CRISPR system may comprise a combination of effector proteins that target RNA and DNA or effector proteins that target both RNA and DNA.
[00201] [00201] The nucleic acid molecule encoding a CRISPR effector protein, in particular C2c2, is advantageously codon-optimized CRISPR effective protein. An example of a codon-optimized sequence is,
[00202] [00202] In certain embodiments, the methods described herein may comprise providing a Cas transgenic cell, in particular a C2c2 transgenic cell, in which one or more nucleic acids encoding one or more guide RNAs are provided or introduced operatively linked into the cell. with a regulatory element comprising a promoter from one or more genes of interest. As used herein, the term "transgenic Cas cell" refers to a cell, such as a eukaryotic cell, into which a Cas gene has been genomically integrated. cell type or origin are not particularly limiting in accordance with the present invention. Also the way in which the Cas transgene is introduced into the cell can vary and can be any method as is known in the art. In certain embodiments, the Cas transgenic cell is obtained by introducing the Cas transgene into an isolated cell. In certain other embodiments, the Cas transgenic cell is obtained by isolating cells from a transgenic organism o Cas. By way of example, and without limitation, the Cas transgenic cell, as referred to herein, may be derived from a Cas transgenic eukaryote, such as a Cas-immune eukaryote. Reference is made to WO2014/093622 (PCT/US13/ 74667), incorporated herein by reference. The methods of US Patent Publications Nos. 20120017290 and 20110265198 assigned to Sangamo BioSciences, Inc. targeted to target the Rose locus may be modified to utilize the Cas CRISPR system of the present invention. The methods of US Patent Publication 20130236946 assigned to Cellectis targeted to target the Rose locus may also be modified to use the Cas CRISPR system of the present invention. By way of another example, reference is made to Platt et.
[00203] [00203] It will be understood by the expert that the cell, such as the transgenic Cas cell, as referred to herein, may comprise other genomic alterations, in addition to having an integrated Cas gene or mutations resulting from the specific action of the Cas sequence when complexed with RNA capable of guide Cas to a destination.
[00204] [00204] In certain aspects, the invention involves vectors, for example to deliver or introduce into a cell Cas and/or RNA capable of guiding Cas to a target locus (i.e. guide RNA), but also to propagate these components (e.g. example, in prokaryotic cells).A used here, a "vector" is a tool that allows or facilitates the transfer of an entity from one environment to another."Vector" refers to a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted in order to replicate the inserted segment. Generally, a vector is capable of replication when associated with the appropriate control elements. As used herein, the term
[00205] [00205] The recombinant expression vectors of the present invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which is to say that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the cells. hosts to be used for expression, which are operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence in a manner that allows the expression of the nucleotide sequence (for example, in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). With regard to recombination and cloning methods, the patent application is mentioned US 10/815,730, published September 2, 2004 as US2004-0171156A1, whose count The content is incorporated herein by reference in its entirety. Thus, the embodiments disclosed herein may also comprise transgenic cells comprising the CRISPR effector system. In certain exemplary embodiments, the transgenic cell may function as an individual discrete volume. In other words, the samples comprising a masking construct can be delivered to a cell, for example, in a suitable delivery vesicle and if the target is present in the delivery vesicle, the CRISPR effector is activated and a detectable signal is generated.
[00206] [00206] The vector(s) may (m) include the regulatory element(s), eg promoter(s). The vector(s) may (m) comprise Cas coding sequences, and/or a single, but possibly also may comprise at least 3 or 8 or 16 or 32 or 48 or 50 guide RNAs(s), e.g. sgRNA coding sequences such as 1-2, 1-3 , 1-41-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-8, 3-16, 3-30, 3-32, 3-48, 3-50RNA (s) (eg, sgRNAs). In a single vector, there may be one promoter for each RNA (eg, sgRNA), advantageously when there are up to about 16RNA(s); and, when a single vector provides more than 16RNAs, one or more promoters can drive the expression of more than one RNAs, for example, when there are 32RNAs,
[00207] [00207] Guide ORNA(s) encoding sequences and/or Cas encoding sequences may be functionally or operatively linked to the regulatory element(s) and therefore to the regulatory element(s) ( The promoter(s) may be constitutive promoters and/or conditional promoter(s) and/or inducible promoter(s) and/or specific promoter(s) ) of tissue. ), the SV40 promoter, the dihydrofolate reductase promoter, the p-actin promoter, the phosphoglycerol kinase (PGK) promoter and the EF1α promoter. An advantageous promoter is the U6 promoter.
[00208] [00208] In some embodiments, one or more elements of a nucleic acid targeting system is derived from a particular organism that comprises an endogenous RNACRISPR targeting system. In certain exemplary embodiments, the RNA targeting system of the CRISPR effector protein comprises at least one HEPN domain, including but not limited to the HEPN domains described herein, HEPN domains known in the art, and domains recognized as HEPN domains compared to consensus sequence motifs. Several such domains are provided here. Limitingly, a consensus sequence can be derived from the sequences of C2c2 or Cas13b orthologs provided herein. In certain exemplary embodiments, the effector protein comprises a single HEPN domain. In certain other exemplary embodiments, the effector protein comprises two HEPN domains.
[00209] [00209] In an exemplary embodiment, the effector protein comprises one or more HEPN domains comprising an RxxxxH motif sequence. The RxxxxH motif sequence can be, without limitation, from a HEPN domain described herein or a HEPN domain known in the art. RxxxxH motif sequences further include motif sequences created by combining portions of two or more HEPN domains. As noted, consensus sequences can be derived from the sequences of the orthologs disclosed in US Provisional Patent Application 62/432,240 entitled Novel CRISPREnzymes and Systems ,” US Interim Patent Application 62/471,710 titled “Novel Type VICRISPROrthologs and Systems” filed March 15, 2017, and US Interim Patent Application titled “Novel Type VICRISPROrthologs and Systems,” labeled attorney file number 47627- 05-2133 and filed on April 12, 2017.
[00210] [00210] In one embodiment of the invention, a HEPN domain comprises at least one RxxxxH motif comprising the sequence of R{N/H/K}X1X2X3H (IDSEQNO:144). In one embodiment of the invention, a HEPN domain comprises an RxxxxH motif comprising the sequence of R{N/H}X1X2X3H (SEQIDNO:145).
[00211] [00211] Additional effectors for use in accordance with the invention can be identified by their proximity to the cas1 genes, for example, although not limited to, within the region 20 kb from the beginning of the cas1 gene and 20 kb from the end of the cas1 gene. In certain embodiments, the effector protein comprises at least one HEPN domain and at least 500 amino acids, and wherein the C2c2 effective protein is naturally present in a prokaryotic genome within 20 kb upstream or downstream of a Cas gene or matrix. CRISPR. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1 , Nsf2, Nsf3, Nsf4, their counterparts or modified versions thereof. In certain exemplary embodiments, the C2c2 effector protein is naturally present in a prokaryotic genome within 20kb upstream or downstream of a Cas1 gene. referred to as "homolog") are well known in the art. By way of further guidance, a "homolog" of a protein as used herein is a protein of the same species that performs the same or a similar function as the protein of which it is a homolog Homologous proteins may, but need not, be structurally related, or are only partially structurally related. An "ortholog" of a protein as used herein is a protein from a different species that performs the same or a similar function as that of which it is an ortholog. Ortholog proteins can, but need not, be structurally related, or are only partially structurally related.
[00212] [00212] In particular embodiments, the Cas enzyme targeting Type VI RNA is C2c2. In other example embodiments, the Cas enzyme targeting Type VI RNA is Cas 13b. In certain embodiments, the Cas13b protein is from an organism of a genus selected from the group consisting of: Bergeyella, Prevotella, Porphyromonas, Bacterioides, Alistipes, Riemerella, Myroides, Capnocytophaga, Porphyromonas, Flavobacterium, Porphyromonas, Chryseobacterium, Paludibacter, Psychroflex, Phaeodactylibacter , Sinomicrobium, Reichenbachiella.
[00213] [00213] In particular embodiments, the homolog or ortholog of a Type VI protein, such as C2c2, as referred to herein, has a homology or sequence identity of at least 30%, or at least
[00214] [00214] In certain other exemplary embodiments, the CRISPR system, the effector protein, is a C2c2 nuclease. The activity of C2c2 may depend on the presence of two HEPN domains. nuclease (in particular an endonuclease). C2c2HEPN can also target DNA or potentially DNA and/or RNA. Based on the fact that the HEPN domains of C2c2 are at least capable of binding and, in their wild-type form, cutting RNA, it is preferable that the C2c2 effector protein has the RNase function. Regarding the C2c2CRISPR systems, reference is made to the US interim standards. 62/351,662 filed June 17, 2016 and USProvisional 62/376,377 filed August 17, 2016. Reference is also made to US Provisional Provisions. 62/351,803 filed on June 17,
[00215] [00215] RNase function in CRISPR systems is known; for example, mRNA targeting has been reported for certain type III CRISPR-Cas systems (Hale et al., 2014, Genes Dev, vol. 28, 2432-2443; Hale et al., 2009, Cell 139, 945-956 ; Peng et al., 2015, Nucleic acid research, vol. 43, 406-417) and provides significant advantages. In the Staphylococcus epidermis type III-A system, transcription between targets results in cleavage of target DNA and its transcripts, mediated by independent active sites within the Cas10-Csm ribonucleoprotein effector protein complex (see Samai et al., 2015, Cell, 151, 1164-1174). A CRISPR-Cas system, composition, or method targeting RNA through the present effector proteins is thus provided.
[00216] [00216] In one embodiment, the Cas protein may be a C2c2 ortholog of an organism of a genus that includes, but is not limited to, Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifator, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flavi, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter. Species of organisms of this genus can be discussed here in another way.
[00217] [00217] Some methods to identify orthologs of CRISPR-Cas system enzymes may involve the identification of tracr sequences in genomes of interest. Identification of tracr sequences may be related to the following steps: Look for the direct repeats or tracer mate sequences in a bank database to identify a CRISPR region comprising a CRISPR enzyme. Look for homologous sequences in the CRISPR region that flank the CRISPR enzyme in both sense and antisense directions. Look for transcriptional terminators and secondary structures. Identify any sequence that is not a direct repeat sequence or tracr mate, but which has more than 50% identity with the direct repeating sequence, or tracr mate as a potential tracr sequence.
[00218] [00218] It will be appreciated that any of the functionalities described herein can be engineered into CRISPR enzymes from other orthologs, including chimeric enzymes comprising fragments of multiple orthologs. Examples of such orthologs are described elsewhere in this document. Thus, chimeric enzymes can comprise ortholog fragments of the CRISPR enzyme from an organism including, but not limited to, Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter. A chimeric enzyme may comprise a first fragment and a second fragment, and the fragments may be from CRISPR enzyme orthologs of organisms of genera mentioned herein or species mentioned herein ; advantageously the fragments are from CRISPR enzyme orthologs of different species.
[00219] [00219] In embodiments, the C2c2 protein as referred to herein also encompasses a functional variant of C2c2 or a homolog or an ortholog thereof. A "functional variant" of a protein as used herein refers to a variant of that protein that retains at least at least partially the activity of that protein.Functional variants may include mutants (which may be insertion, deletion or substitution), including polymorphs, etc. Also included in functional variants are fusion products of this protein with another nucleic acid, protein, polypeptide or peptide, usually unrelated. Functional variants may occur naturally or may be man-made. Advantageous modalities may involve engineered or non-naturally occurring RNA Type VI-targeted effector protein.
[00220] [00220] In one embodiment, the nucleic acid molecule(s) encoding C2c2, or an ortholog or homolog thereof, can be codon-optimized for expression in a eukaryotic cell. A eukaryote can be as discussed herein. Nucleic acid molecules can be engineered or unnatural.
[00221] [00221] In one embodiment, the C2c2 or an ortholog or homolog thereof may comprise one or more mutations (and therefore nucleic acid molecule(s) encoding the same may have mutation(s). The mutations may be artificially introduced mutations and may include, but are not limited to, one or more mutations in a catalytic domain. Examples of catalytic domains referencing a Cas9 enzyme may include, but are not limited to, RuvCI, RuvCII, RuvCIII, and HNH domains.
[00222] [00222] In one embodiment, the C2c2, or an ortholog or homolog thereof, may comprise one or more mutations. Mutations may be artificially introduced mutations and may include, but are not limited to, one or more mutations in a catalytic domain. Examples of catalytic domains with reference to a Cas enzyme may include, but are not limited to, HEPN domains.
[00223] [00223] In one embodiment, the C2c2, or an ortholog or homolog thereof, can be used as a generic nucleic acid binding protein fused to or operatively linked to a functional domain. Examples of functional domains may include, but are not limited to, translation initiator, translation activator, translation repressor, nucleases, in particular ribonucleases, a spliceosome, beads, a light inducible/controllable domain or a chemically inducible/controllable domain.
[00224] [00224] In certain exemplary embodiments, the C2c2 effector protein may be from an organism selected from the group consisting of; Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor,
[00225] [00225] In certain embodiments, the effector protein may be a Listeria sp.C2c2p, preferably Listeria seeligeria C2c2p, more preferably Listeria seeligeria serovar 1/2b str.SLCC3954C2c2p, and the crRNA sequence may be 44 to 47 nucleotides in length, with a 5' 29-nt direct repeat (DR) and a 15-nt to 18-nt spacer.
[00226] [00226] In certain embodiments, the effector protein may be a Leptotrichia sp.C2c2p, preferably Leptotrichia shahii C2c2p, more preferably Leptotrichia shahii DSM19757C2c2p, and the crRNA sequence may be 42 to 58 nucleotides in length, with a 5' forward repeat. at least 24 nt, such as a 5' forward sequence 24-28-nt repeat (DR) and a spacer of at least 14 nt, such as a spacer of 14 to 28 nt, or a spacer of at least 18 nt, such as 19 , 20, 21, 22 or more nt, such as 18-28, 19-28, 20-28, 21-28 or 22-28 nt.
[00227] [00227] In certain exemplary embodiments, the effector protein may be a Leptotrichia sp., Leptotrichia wadei F0279 or a Listeria sp., preferably Listeria newyorkensis FSLM6-0635.
[00228] [00228] In certain exemplary embodiments, the C2c2 effector proteins of the invention include, without limitation, the following 21 ortholog species (including various CRISPR loci: Leptotrichia shahii; Leptotrichia wadei (Lw2); Listeria seeligeri; Lachnospiraceae bacterium MA2020; Lachnospiraceae bacterium NK4A179; [Clostridium] aminophilum DSM10710; Carnobacterium gallinarum DSM4847, DSM4847 Carnobacterium gallinarum (second CRISPRLoci); Paludibacter propionicigenes wb4; Listeria weihenstephanensis FSLR9-0317; Listeriaceae bacterium FSLM6-0635; Leptotrichia wadei F0279, Rhodobacter capsulatus SB1003, Rhodobacter capsulatus R121; Rhodobacter capsulatus DE442; Leptotrichia buccalis C-1013-b; Herbinix hemicellulosilytica; [Eubacterium] rectale; Eubacteriaceae bacterium CHKCI004; Blautia sp. Marseille-P2398; and Leptotrichia sp. oral taxon 879 str.F0557. Twelve (12) other non-limiting examples are: Lachnospiraceae bacterium NK4A144; Chloroflexus aggregans; Demequina aurantiaca; Thalassospira sp. TSL5-1; Pseudobutyrivibrio sp.OR37; Butyrivibrio sp.YAB3001; Blautia sp.Marseille-P2398; Leptotrichia sp.Marseille-P3007; Bacteroides ihuae; Porphyromonadaceae bacterium KH3CP3RA; Listeria riparia; and Insolitispirillum peregrinum.
[00229] [00229] In certain embodiments, the C2c2 protein according to the invention is or is derived from one of the orthologs, as described in the table below, or is a chimeric protein from two or more of the orthologs, as described in the table below, or is a mutant or variant of one of the orthologs,
[00230] [00230] In certain exemplary embodiments, the C2c2 effector protein is from an organism selected from the group consisting of: Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium , Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, and Lachnospira.
[00231] [00231] In certain exemplary embodiments, the C2c2 effector protein is selected from Table 1 below.
[00232] [00232] The wild-type protein sequences of the above species are listed in Table 2 below. In certain embodiments, a nucleic acid sequence encoding the C2c2 protein is provided.
[00233] [00233] In one embodiment of the invention, an effector protein is provided which comprises an amino acid sequence having at least 80% sequence homology to the wild-type sequence of any of the bacteria Leptotrichia shahii C2c2, Lachnospiraceae bacterium MA2020C2c2, Lachnospiraceae bacterium NK4A179C2c2, Clostridium aminophilum (DSM10710) C2c2, Carnobacterium gallinarum (DSM4847) C2c2, Paludibacter propionicigenes (WB4) C2c2, Listeria weihenstephanensis (FSLR9-0317) C2c2, Listeriaceae bacterium (FSLM6-0635) C2c2, Listeria newyorkensis (FSLR9-0317) C2c2, Listeriaceae bacterium (FSLM6-0635) C2c2, Listeria newyorkensis (FSLR9-0317) C2c2, Listeriaceae bacterium (FSLM6-0635) C2c2, Listeria newyorkensis (FSLR9-0317) C2c2, Listeriaceae bacterium (FSLM6-0635) C2c2, Listeria newyorkensis (FSLR9-0317) C2062,5LM6c-2062,5LM6c-206235LM6 Leptotrichia wadei (F0279) C2c2, Rhodobacter capsulatus (SB1003) C2c2, Rhodobacter capsulatus (R121) C2c2, Rhodobacter capsulatus (DE442) C2c2, Leptotrichia wadei (Lw2) C2c2, or Listeria seeligeri C2c2.
[00234] [00234] In one embodiment of the invention, the effector protein comprises an amino acid sequence having at least 80% sequence homology to a Type VI effective protein consensus sequence, including, but not limited to, a consensus sequence herein described.
[00235] [00235] According to the invention, a consensus sequence can be generated from multiple orthologs
[00236] [00236] In another non-limiting example, a sequence alignment tool to assist in generating a consensus sequence and identifying conserved residues is the MUSCLE alignment tool (www.ebi.ac.uk/Tools/msa/muscle/ ). For example, using MUSCLE, the following conserved amino acid sites among the C2c2 orthologs can be identified in Leptotrichia wadei C2c2:K2; K5; V6; E301; L331; I335; N341; G351; K352; E375; L392; L396; D403; F446; I466; I470; R474 (HEPN); H475; H479 (HEPN), E508; P556; L561; I595; Y596; F600; Y669; I673; F681; L685; Y761; L676; L779; Y782; L836; D847; Y863; L869; I872; K879; I933; L954; I958; R961; Y965; E970; R971; D972; R1046 (HEPN), H1051 (HEPN), Y1075; D1076; K1078; K1080; I1083; I1090
[00237] [00237] An exemplary sequence alignment of HEPN domains showing highly conserved residues is shown in FIG. 50
[00238] [00238] In certain exemplary embodiments, the RNA-targeted effector protein is an effector protein of Type
[00239] [00239] In certain exemplary embodiments, the wild-type sequence of the Cas13b ortholog is found in Table 4 or 5 below.
[00240] [00240] In certain exemplary embodiments, the RNA-targeted effector protein is a Cas13c effector protein, as disclosed in the U.S. Provisional Patent Application.
[00241] [00241] In certain exemplary embodiments, the Cas13 protein may be selected from any of the following.
[00242] [00242] In certain exemplary embodiments, the assays may comprise multiple Cas12 orthologs or one or more orthologs in combination with one or more Cas13 orthologs. In certain example embodiments, the Cas12 orthologs are Cpf1 orthologs. In certain other example embodiments , Cas12 orthologs are C2c1 orthologs.
[00243] [00243] The present invention encompasses the use of a Cpf1 effector protein, derived from a Cpf1 locus indicated as subtype VA. Here, these effector proteins are also called "Cpf1p", for example a Cpf1 protein (and this effector protein or Cpf1 protein or protein derived from a Cpf1 locus is also called a "CRISPR enzyme"). encompasses cas1, cas2, a distinct gene denoted cpf1, and a CRISPR matrix. Cas9 along with an equivalent of the characteristic arginine-rich Cas9 cluster. However, Cpf1 lacks the HNH nuclease domain that is present in all Cas9 proteins, and the RuvC-like domain is contiguous in the Cpf1 sequence, in contrast to Cas9, where it contains long inserts, including the HNH domain. Therefore, in particular embodiments, the CRISPR-Cas enzyme comprises only a RuvC-like nuclease domain.
[00244] [00244] The programmability, specificity, and collateral activity of RNA-guided Cpf1 also make it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, a Cpf1 system is designed to provide for and take advantage of non-specific RNA collateral cleavage. .In another embodiment, a Cpf1 system is designed to provide for and take advantage of the non-specific collateral cleavage of ssDNA. Therefore, the designed Cpf1 systems provide platforms for nucleic acid detection and transcriptome manipulation. OCpf1 is designed to be used as a Mammalian transcriptional knockdown and ligation tool. OCpf1 is capable of robust collateral cleavage of RNA and ssDNA when activated by binding to sequence-specific targeted DNA.
[00245] [00245] The terms "ortholog" (also referred to herein as "ortholog") and "homolog" (also referred to herein as "homolog") are well known in the art. By way of further guidance, a "homolog" of a protein such as used herein is a protein of the same species that performs the same or a similar function as the protein of which it is a homolog. Homologous proteins may, but need not, be structurally related, or are only partially structurally related. An "ortholog" of a protein as used herein is a protein from a different species that performs the same or a similar function as that of which it is an ortholog. Orthologous proteins may, but need not, be structurally related, or are only partially structurally related. be identified by homology modeling (see, for example, Greer, Science vol. 228 (1985) 1055, and Blundell et al.Eur JBiochem vol 172 (1988), 513) or "structural BL AST" (Dey F, Cliff Zhang Q, Petrey D, Honig B. Toward a "structural BLAST": using structural relationships to infer function. Protein Sci.2013Apr;22(4):359-66. It hurts:
[00246] [00246] The Cpf1 gene is found in several diverse bacterial genomes, usually at the same location with the cas1, cas2 and cas4 genes and a CRISPR cassette (eg FNFX1_1431-FNFX1_1428 from Francisella cf. novicida Fx1). Thus, the layout of this new putative CRISPR-Cas system appears to be similar to type II-B. In addition, similar to Cas9, the Cpf1 protein contains a readily identifiable C-terminal region that is homologous to the ORF-B transposon and includes an active RuvC-like nuclease, an arginine-rich region, and a Zn finger (absent in Cas9). However, unlike Cas9, Cpf1 is also present in several genomes without a CRISPR-Cas context and its relatively high similarity to ORF-B suggests that it may be a component of the transposon. genuine CRISPR-Cas system and Cpf1 were a functional analogue of Cas9, it would be a new type of CRISPR-Cas, type V (see Annotation and Classification of CRISPR-Cas Systems.Makarova KS, Koonin EV.Methods Mol Biol.2015; 1311:47-75). However, as described herein, Cpf1 is indicated to be in the VA subtype to distinguish it from C2c1p which does not have an identical domain structure and is therefore indicated to be in the VB subtype.
[00247] [00247] In particular embodiments, the effector protein is a Cpf1 effector protein from an organism of a genus comprising Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eactobacterium, Lactobacillus, Ephylococcus .,Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanometthyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatillus, Tubitaminibilus, Bacillobacterus, Bacon.
[00248] [00248] In other particular embodiments, the Cpf1 effector protein is from an organism selected from S. mutans, S. agalactiae, S. equisimilis, S. sanguinis, S.
[00249] [00249] The effector protein may comprise a chimeric effective protein comprising a first fragment of a first effective protein ortholog (e.g. a Cpf1) and a second fragment of a second effector protein ortholog (e.g. a Cpf1) and in that the first and second effector protein orthologs are different. At least one of the first and second effector protein orthologs (eg, a Cpf1) may comprise an effector protein (eg, a Cpf1) from an organism comprising Streptococcus, Campylobacter , Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Prevoromona , Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutacea and, Tuberibacillus, Bacillus, Brevibacillus, Methylobacterium or Acidaminococcus; for example, a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a Cpf1 from an organism comprising Streptococcus, Campylobacter, Nitratifrator, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter , Azospirillum, Sphaerocha. Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanometethyophilus, Porphyromocroidea, Desotella, Brevibacilus, Methylobacterium or Acidaminococcus in which the first and second fragments are not from same bacterium; for example, a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a Cpf1 of S. mutans, S. agalactiae, S.
[00250] [00250] In a more preferred embodiment, the Cpf1p is derived from a bacterial species selected from Francisella tularensis 1, Prevotella albensis, Lachnospiraceae bacterium MC20171, Butyrivibrio proteoclaticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp.BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens and Porphyromonas macacae. In certain embodiments, the Cpf1p is derived from a selected bacterial species of Acidaminococcus sp.BV3L6, Lachnospiraceae bacterium MA2020.
[00251] [00251] In some embodiments, the Cpf1p is derived from an organism of the genus Eubacterium. In some embodiments, the CRISPR effector protein is a Cpf1 protein derived from an organism of the bacterial species of
[00252] [00252] In particular embodiments, the homolog or ortholog of Cpf1 as referred to herein has a homology or sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as, for example, at least 95% with Cpf1. In other embodiments, the Cpf1 homolog or ortholog as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for example at least 95% with wild-type Cpf1. When Cpf1 has one or more mutations (mutated), the homolog or ortholog of said Cpf1, as referred to herein, has a sequence identity of at least 80%, plus preferably at least 85%, even more preferably at least 90%, for example at least 95% with the mutated Cpf1.
[00253] [00253] In an ambodiment, the Cpf1 protein may be an ortholog of an organism of a genus that includes, but is not limited to, Acidaminococcus sp, Lachnospiraceae bacterium or Moraxella bovoculi; in particular embodiments, the Cas type V protein may be an ortholog of an organism of a species that includes, but is not limited to, Acidaminococcus sp. BV3L6; Lachnospiraceae bacterium ND2006 (LbCpf1) or Moraxella bovoculi 237. In particular embodiments, the Cpf1 homolog or ortholog as referred to herein has a homology or sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as at least 95% with one or more of the Cpf1 sequences disclosed herein. In other embodiments, the Cpf homolog or ortholog as referred to herein has a sequence identity of at least 80%, plus preferably at least 85%, even more preferably at least 90%, such as for example at least 95% with wild-type FnCpf1, AsCpf1 or LbCpf1.
[00254] [00254] In particular embodiments, the Cpf1 protein of the invention has a homology or sequence identity of at least 60%, more particularly at least 70, such as at least 80%, more preferably at least 85%, even more preferably at least 90 %, for example at least 95% with FnCpf1, AsCpf1 or LbCpf1. In other embodiments, the Cpf1 protein as referred to herein has a sequence identity of at least 60%, such as at least 70%, more particularly at least 80%, more preferably at least 85%, even more preferably at least 90 %, e.g. at least 95% with wild type AsCpf1 or LbCpf1. In particular embodiments, the Cpf1 protein of the present invention has less than 60% sequence identity with FnCpf1. The skilled person will understand that this includes truncated forms of the protein Cpf1, by which sequence identity is determined along the length of the truncated form.
[00255] [00255] In some of the following, amino acids
[00256] [00256] Other Cpf1 orthologs include
[00257] [00257] The present invention encompasses the use of C2c1 effector proteins, derived from a C2c1 locus indicated as subtype V-B. Here, these effector proteins are also called "C2c1p", for example a C2c1 protein (and this effector protein or C2c1 protein or protein derived from a C2c1 locus is also called a "CRISPR enzyme").
[00258] [00258] C2c1 proteins (also known as Cas12b) are RNA-guided nucleases. Their cleavage relies on a tracr RNA to recruit a guide RNA that comprises a guide sequence and a direct repeat, in which the guide sequence hybridizes to the nucleotide sequence target to form a heteroduplex DNA/RNA. Based on current studies, C2c1 nuclease activity also requires PAM sequence recognition. C2c1PAM sequences are T-rich sequences. In some embodiments, the PAM sequence is 5' TTN3 ' or 5'ATTN3', where N is any nucleotide. In a particular embodiment, the PAM sequence is 5'TTC3'. In a particular embodiment, the PAM is in the sequence of Plasmodium falciparum.
[00259] [00259] C2c1 creates a staggered cut at the target location, with a 5' overhang or a “sticky end” on the PAM distal side of the target sequence. In some embodiments, the 5' overhang is 7 nt. See Lewis and Ke , Mol Cell. 2017 Feb 2;65(3):377-379.
[00260] [00260] The invention provides C2c1 (Type VB; Cas12b) effector proteins and orthologs. The terms "ortholog" (also referred to herein as "ortholog") and "homologous" (also referred to herein as "homologous") are well known in the art. .By further guidance, a "homolog" of a protein as used herein is a protein of the same species that performs the same or a similar function as the protein of which it is a homolog. Homologous proteins may, but need not, be related structurally,
[00261] [00261] The C2c1 gene is found in several diverse bacterial genomes, typically at the same location with the cas1, cas2 and cas4 genes and a CRISPR cassette. Thus, the layout of this new putative CRISPR-Cas system appears to be similar to the type II- B. In addition, similar to Cas9, the C2c1 protein contains an active RuvC-like nuclease, an arginine-rich region, and a Zn finger (absent in Cas9).
[00262] [00262] In particular embodiments, the effector protein is a C2c1 effector protein from an organism of a genus comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Citrobacter, Elusimicrobia, Methylobacterium, Omnitrophica, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae.
[00263] [00263] In other particular embodiments, the C2c1 effector protein is from a selected species of Alicyclobacillus acidoterrestris (eg ATCC49025), Alicyclobacillus contaminans (eg DSM17975), Alicyclobacillus macrosporangiidus (eg DSM17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g. DSM10711), Desulfonatronum thiodismutans (e.g. MLF-1 strain), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium 4RBG_10, Spictomycetes bacterium 4RBG_10 bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (eg DSM17572), Bacillus thermoamylovorans (eg strain B4166), Brevibacillus sp. CF112, Bacillus sp.NSP2.1, Desulfatirhabdium butyrativorans (eg DSM18734),
[00264] [00264] The effector protein may comprise a chimeric effector protein comprising a first fragment of a first effector protein ortholog (e.g., a C2c1) and a second fragment of a second effector protein ortholog (e.g., a C2c1) and in that the first and second effector protein orthologs are different. At least one of the first and second effector protein orthologs (eg, a C2c1) may comprise an effective protein (eg, a C2c1) from an organism comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabd Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes and Verrucomicrobiaceae; for example, a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a C2c1 of an organism comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus ,
[00265] [00265] In a more preferred embodiment, the C2c1p is derived from a selected bacterial species of Alicyclobacillus acidoterrestris (e.g. ATCC49025), Alicyclobacillus contaminans (e.g. DSM17975), Alicyclobacillus macrosporangiidus (e.g. DSM17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g. DSM10711), Desulfonatronum thiodismutans (e.g. MLF-1 strain), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium 4RBG_10, Spictomycetes bacterium 4RBG_10 bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (eg DSM17572), Bacillus thermoamylovorans (eg strain B4166), Brevibacillus sp. CF112, Bacillus sp.NSP2.1, Desulfatirhabdium butyrativorans (e.g. DSM18734), Alicyclobacillus herbarius (e.g. DSM13609), Citrobacter freundii (e.g. ATCC8090), Brevibacillus agri (e.g. BAB-2500), Methylobacterium nodulans (e.g. eg ORS2060). In certain embodiments, C2c1p is derived from a selected bacterial species of Alicyclobacillus acidoterrestris (eg ATCC49025),
[00266] [00266] In particular embodiments, the homolog or ortholog of C2c1, as referred to herein, has a homology or sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, as for example at least 95% with C2c1. In other embodiments, the homolog or ortholog of C2c1, as referred to herein, has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for example at least 95% with wild-type C2c1. When C2c1 has one or more mutations (mutated), the homolog or ortholog of said C2c1 as referred to herein has a sequence identity of at least 80% plus preferably at least 85%, even more preferably at least 90%, for example at least 95% with the mutated C2c1.
[00267] [00267] In one embodiment, the C2c1 protein may be an ortholog of an organism of a genus that includes, but is not limited to, Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacterium , Phycisphaerae, Planctomycetes, Spirochaetes and Verrucomicrobiaceae; in particular embodiments, the Cas type V protein may be an ortholog of an organism of a species that includes, but is not limited to, Alicyclobacillus acidoterrestris (e.g.,
[00268] [00268] In particular embodiments, the C2c1 protein of the invention has a homology or sequence identity of at least 60%, more particularly at least 70, such as at least 80%, more preferably at least 85%, even more preferably at least 90 %, for example at least 95% with AacC2c1 or BthC2c1. In other embodiments, the C2c1 protein as referred to herein has a sequence identity of at least 60%, such as at least 70%, more particularly at least 80%, more preferably at least 85%, even more preferably at least 90 %, e.g. at least 95% with wild type AacC2c1. In particular embodiments, the C2c1 protein of the present invention has less than 60% sequence identity with AacC2c1. The skilled person will understand that this includes truncated forms of the C2c1 protein, whereby sequence identity is determined along the length of the truncated form.
[00269] [00269] In certain methods according to the present invention, the CRISPR-Cas protein is preferentially mutated with respect to a corresponding wild-type enzyme, such that the mutated CRISPR-Cas protein does not have the ability to cleave one or both of these enzymes. DNA strands from a target locus containing an enzyme. target sequence. In particular embodiments, one or more catalytic domains of the C2c1 protein are mutated to produce a mutated Cas protein that cleaves only one strand of DNA from a target sequence.
[00270] [00270] In particular embodiments, the CRISPR-Cas protein may be mutated relative to a corresponding wild-type enzyme such that the mutated CRISPR-Cas protein does not possess substantially all of the DNA cleavage activity. CRISPR-Cas protein can be considered to have substantially all of the DNA and/or RNA cleavage activity when the cleavage activity of the mutated enzyme does not exceed 25%, 10%, 5%, 1%, 0.1%, 0.01%, or less the nucleic acid cleaving activity of the unmutated form of the enzyme; an example may be when the nucleic acid cleaving activity of the mutated form is null or negligible compared to the unmutated form.
[00271] [00271] In certain embodiments of the methods provided herein, the CRISPR-Cas protein is a mutated protein from
[00272] [00272] In certain embodiments, the C2c1 protein is a catalytically inactive C2c1 comprising a mutation in the RuvC domain. In some embodiments, the catalytically inactive C2c1 protein comprises a mutation corresponding to D570A, E848A or D977A in Alicyclobacillus acidoterrestris C2c1.
[00273] [00273] The programmability, specificity, and collateral activity of RNA-guided C2c1 also make it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, a C2c1 system is designed to provide for and take advantage of non-specific collateral cleavage of RNA .In another embodiment, a C2c1 system is designed to provide and take advantage of non-specific collateral cleavage of ssDNA. Therefore, engineered C2c1 systems provide platforms for nucleic acid detection and transcriptome manipulation and induce cell death. developed for use as a mammalian transcriptional ligation and knockdown tool. OC2c1 is capable of robust collateral cleavage of RNA and ssDNA when activated by binding to sequence-specific targeted DNA.
[00274] [00274] In certain embodiments, C2c1 is provided or expressed in an in vitro system or in a cell, transiently or stably, and targeted or triggered to non-specifically cleave cellular nucleic acids. In one embodiment, C2c1 is engineered to knock down ssDNA, for example, viral ssDNA. In another embodiment, C2c1 is designed to knock down RNA. The system can be designed so that the knockdown is dependent on a target DNA present in the cell or system in vitro, or triggered by the addition of an acid target nucleic to the system or cell.
[00275] [00275] In one embodiment, the C2c1 system is engineered to cleave RNA non-specifically in a subset of cells distinguishable by the presence of an aberrant DNA sequence, for example, where cleavage of the
[00276] [00276] Collateral activity has recently been leveraged to a highly sensitive and specific nucleic acid detection platform called SHERLOCK, useful for many clinical diagnoses (Gootenberg, JS et al. Nucleic acid detection with CRISPR-Cas13a/C2c2.Science 356, 438 -442 (2017)).
[00277] [00277] In accordance with the invention, engineered C2c1 systems are optimized for DNA or RNA endonuclease activity and can be expressed in mammalian cells and targeted to effectively knock down reporter molecules or transcripts in cells.
[00278] [00278] As used herein, the term "leader sequence" and "leader molecule" in the context of a CRISPR-Cas system, comprises any polynucleotide sequence with sufficient complementarity to a target nucleic acid sequence to hybridize to the target nucleic acid sequence. and direct sequence-specific binding of a nucleic acid targeting complex to the target nucleic acid sequence. Guide sequences made using the methods disclosed herein can be a complete guide sequence, a truncated guide sequence, a complete sgRNA sequence, a sgRNA sequence truncated or an E+F sgRNA sequence. In some embodiments, the degree of complementarity of the leader sequence to a given target sequence, when ideally aligned using a suitable alignment algorithm, is approximately or more than approximately 50%, 60%, 75%, 80%, 85%, 90%,
[00279] [00279] As used in this document, the term
[00280] [00280] In certain embodiments, the guide sequence or spacer length of the guide molecules is 15 to 50 nt. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides. In certain embodiments, the spacer length is from 15 to 17 nt, e.g. 15, 16 or 17 nt, from 17 to 20 nt, e.g. 17, 18, 19 or 20 nt, from 20 to 24 nt, e.g. 20, 21, 22, 23 or 24 nt, from
[00281] [00281] In some embodiments, the sequence of the lead molecule (direct repeat and/or spacer) is selected to reduce the degree of secondary structure in the lead molecule. In some embodiments, approximately or less than approximately 75%, 50%, 40% , 30%, 25%, 20%, 15%, 10%, 5%, 1%, or less of the nucleic acid targeting guide RNA nucleotides participate in self-complementary base pairing when optimally folded. ideal can be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimum Gibbs free energy. An example of such an algorithm is mFold, as described by Zuker and Stiegler
[00282] [00282] In some embodiments, it is of interest to reduce the susceptibility of the lead molecule to RNA cleavage, such as cleavage by Cas13. Therefore, in particular embodiments, the lead molecule is adjusted to prevent cleavage by Cas13 or other cleavage enzymes of RNA.
[00283] [00283] In certain embodiments, the lead molecule comprises non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogues, and/or chemically modified. Preferably, these non-naturally occurring nucleic acids and nucleotides are located outside the guide sequence.Non-naturally occurring nucleic acids may include, for example, mixtures of naturally occurring and non-naturally occurring nucleotides.Non-naturally occurring nucleotides and/or nucleotide analogues may be modified in ribose, phosphate and/or base moiety. In one embodiment of the invention, a lead nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, a lead comprises one or more ribonucleotides and one or more deoxyribonucleotides. In one embodiment of the invention, the lead comprises one or more nucleotides or nucleotide analogues that do not occur naturally, such as a phosphorothioate-linked nucleotide, a blocked nucleic acid nucleotide
[00284] [00284] In some embodiments, a nucleic acid targeting guide is selected to reduce the degree of secondary structure within the nucleic acid targeting guide. In some embodiments, approximately or less than about 75%, 50%, 40% , 30%, 25%, 20%, 15%, 10%, 5%, 1% or less of the nucleic acid targeting guide nucleotides participate in self-complementary base pairing when ideally folded. Optimal folding can be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimum Gibbs free energy. An example of such an algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133- 148). Another example of a folding algorithm is the RNAfold online server, developed at the Institute of Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see, for example, ARGruber et al.,
[00285] [00285] In certain embodiments, a guide RNA or crRNA may comprise, essentially consist of, or consist of a direct repeat (DR) sequence and a guide sequence or spacer sequence. In certain embodiments, the guide RNA or crRNA may comprise , essentially consisting of, or consisting of a direct repeat sequence fused or linked to a leader sequence or spacer sequence. In certain embodiments, the direct repeat sequence may be located upstream (i.e., 5') of the leader sequence or spacer. In other embodiments, the forward repeat sequence may be located downstream (ie, 3') of the guide sequence or spacer sequence.
[00286] [00286] In certain embodiments, the crRNA comprises a stem loop, preferably a single stem loop. In certain embodiments, the direct repeat sequence forms a stem loop, preferably a single stem loop.
[00287] [00287] In certain embodiments, the length of the lead RNA spacer is 15 to 35 nt. In certain embodiments, the length of the lead RNA spacer is at least 15 nucleotides. In certain embodiments, the spacer length is 15 nt. at 17 nt, for example 15,
[00288] [00288] In general, CRISPR-Cas system, CRISPR-Cas9 or CRISPR system can be used in previous documents such as WO2014/093622 (PCT/US2013/074667) and collectively refers to transcripts and other elements involved in expression or targeting of the activity of CRISPR-associated genes ("Cas"), including sequences encoding a Cas gene, in particular a Cas9 gene in the case of CRISPR-Cas9, a tracr sequence (trans activating CRISPR) (e.g. tracrRNA or a tracrRNA active partial), a tracr-mate sequence (which includes a "forward repeat" and a forward partial repeat processed by tracrRNA in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of a CRISPR system endogenous) or "RNA(s)", as that term is used here (e.g. RNA(s) to guide Cas9, e.g. RNACRISPR and transactivating RNA (tracr) or a single guide RNA (sgRNA) (chimeric RNA) ) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also called a protospacer in the context of an endogenous CRISPR system).
[00289] [00289] In the embodiments of the invention, the terms guide sequence and guide RNA, that is, RNA capable of guiding Cas to a target genomic locus, are used interchangeably as in the documents cited above, such as WO2014/093622 (PCT/US2013/ 074667). In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize to the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when ideally aligned using a proper alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%,95%, 97.5%, 99% or more. Optimal alignment can be determined using any suitable algorithm for sequence alignment, of which a non-limiting example includes the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, Trait-based algorithms. Burrows-Wheeler information (eg, the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com),
[00290] [00290] In some embodiments of CRISPR-Cas systems, the degree of complementarity between a guide sequence and its corresponding target sequence may be over or more than over 50%, 60%, 75%, 80%, 85%, 90% , 95%, 97.5%, 99%, or 100%; a guide or RNA or sgRNA can be about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27.28, 29, 30, 35, 40, 45, 50, 75 or more nucleotides in length; or guide or RNA or sgRNA can be less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 or less nucleotides in length; and advantageously the tracr RNA is 30 or 50 nucleotides in length. However, one aspect of the invention is to reduce off-target interactions, for example, to reduce the guide that interacts with a target sequence with low complementarity. shown that the invention involves mutations that result in the CRISPR-Cas system being able to distinguish between target and non-target sequences that have greater than 80% to about 95% complementarity, e.g. 83%-84% or 88-89 % or 94-95% complementarity (for example, distinguishing between a target with 18 nucleotides and a target outside 18 nucleotides with 1, 2 or 3 mismatches). Therefore, in the context of the present invention, the degree of complementarity between a guide sequence and its corresponding target sequence is greater than 94.5% or 95% or 95.5% or 96% or 96.5% or 97% or 97.5% or 98% or 98.5% or 99% or 99.5% or 99.9%, or 100%. Out of reach objective is less than 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% or 94% or 93% or 92% or 91% or 90% or 89% or 88% or 87% or 86% or 85% or 84% or 83% or 82% or 81% or 80% complementarity between the sequence and the guide, with it being advantageous that the off-target is of 100% or 99.9% or 99.5% or 99.5% or 99% or 99% or 98 complementarity, 5% or 98% or 97.5% or 97% or 96.5% or 95.5% or 95% or 94.5% between the sequence and the guide.
[00291] [00291] In certain embodiments, guides to the invention comprise non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogues and/or chemical modifications. Non-naturally occurring nucleic acids may include, for example , mixtures of naturally occurring and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and/or nucleotide analogues may be modified at the ribose, phosphate and/or base moiety. In one embodiment of the invention, a lead nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, a lead comprises one or more ribonucleotides and one or more deoxyribonucleotides. In one embodiment of the invention, the lead comprises one or more nucleotides or nucleotide analogues that do not occur naturally, such as a phosphorothioate-bonded nucleotide, boranophosphate-bonded, a blocked nucleic acid nucleotide
[00292] [00292] In certain embodiments, the CRISPR system as provided herein may make use of a crRNA or polynucleotide analog comprising a guide sequence, wherein the polynucleotide is RNA, DNA, or a mixture of RNA and DNA, and/or wherein the polynucleotide comprises one or more nucleotide analogues. The sequence may comprise any structure, including, but not limited to, the structure of a native crRNA, such as a bulge, hairpin, or stem loop structure. In certain embodiments, the polynucleotide comprising the leader sequence forms a duplex with a second polynucleotide sequence which may be an RNA or DNA sequence.
[00293] [00293] In certain embodiments, use is made of chemically modified guide RNAs. Examples of chemical modifications of guide RNA include, without limitation, incorporation of 2′-O-methyl (M), 2′-O-methyl 3′phosphorothioate ( MS) or 2′-O-methyl 3′thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guide RNAs may comprise greater stability and greater activity compared to unmodified guide RNAs, although on-target versus off-target specificity target is not predictable. (See Hendel, 2015, Nat Biotechnol.33(9):985-9, doi: 10.1038/nbt.3290, published online June 29, 2015). Chemically modified guide RNAs further include , without limitation, RNAs with phosphorothioate bonds and blocked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2' and 4' carbons of the ribose ring.
[00294] [00294] In some embodiments, a guide sequence is about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20 , 15, 12 or less nucleotides in length. Preferably, the guide sequence is 10 to 30 nucleotides. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence can be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex,
[00295] [00295] In some embodiments, the guide modification is a chemical modification, an insertion, an deletion, or a split. In some embodiments, the chemical modification includes, but is not limited to, incorporation of 2'-O-methyl analogs ( M), 2'-deoxy analogs, 2-thiouridine analogs, N6-methyladenosine analogs, 2'-fluoro analogs, 2-aminopurine, 5-bromo-uridine, pseudouridine (Ψ), N1-methylpseudouridine (me1Ψ), 5-methoxyuridine (5moU), inosine, 7-methylguanosine, 2'-O-methyl-3'-phosphorothioate (MS), S-restricted Ethyl (cEt), phosphorothioate (PS) or 2'-O-methyl-3'-thioPACE (MSP). In some embodiments, the guide comprises one or more phosphorothioate modifications. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 25 nucleotides of the guide is chemically modified. In certain embodiments, one or more nucleotides in the seed region are chemically modified. In certain embodiments, one or more nucleotides at the 3' terminus are chemically modified. In certain embodiments, none of the nucleotides in the 5' loop are chemically modified. In some embodiments, the chemical modification in the seed region is a minor modification, such as incorporation of a 2'-fluoro analog. In a specific embodiment, a nucleotide in the seed region is replaced with a 2'-fluoro analog. In some embodiments, 5 or 10 nucleotides at the 3' terminus are chemically modified. Such chemical modifications at the 3' terminus of the Cpf1CrRNA improve gene slicing efficiency (see Li, et al., Nature Biomedical Engineering, 2017, 1:0066). In a specific embodiment, 5 nucleotides at the 3' terminus are replaced by analogs 2 '-fluoro. In a specific embodiment, 10 nucleotides at the 3' terminus are replaced by 2'-fluoro analogs. In a specific embodiment, 5 nucleotides at the 3' terminus are substituted by 2'-O-methyl (M) analogs.
[00296] [00296] In some embodiments, the loop of the 5' handle of the guide is modified. In some embodiments, the handle of the 5' handle is
[00297] [00297] A guide sequence and therefore a nucleic acid targeting guide RNA can be selected to target any target nucleic acid sequence. In the context of forming a CRISPR complex, "target sequence" refers to a sequence in which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term "target RNA" refers to an RNA polynucleotide that is or comprises the target sequence. In other words, the target RNA can be an RNA polynucleotide or a part of an RNA polynucleotide to which a part of the gRNA, that is, the guide sequence, is designed to have complementarity and to which effective function mediated by the complex comprising the CRISPR effector protein and a gRNA must be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell ula. The target sequence may be DNA. The target sequence may be any RNA sequence. In some embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of messenger RNA (mRNA), pre- mRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), double-stranded RNA (dsRNA) , non-coding RNA (ncRNA), long non-coding RNA (lncRNA) and small cytoplasmic RNA (scRNA). In some preferred embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of mRNA, pre-mRNA, and rRNA. In some preferred embodiments, the target sequence may be a sequence within a molecule of RNA selected from the group consisting of ncRNA and lncRNA. In some more preferred embodiments, the target sequence may be a sequence within an mRNA molecule or a pre-mRNA molecule.
[00298] [00298] In certain embodiments, the length of the lead RNA spacer is less than 28 nucleotides. In certain embodiments, the length of the lead RNA spacer is at least 18 nucleotides and less than 28 nucleotides. In certain embodiments, the spacer length of guide RNA is between 19 and 28 nucleotides. In certain embodiments, the length of the guide RNA spacer is between 19 and 25 nucleotides. In certain embodiments, the length of the guide RNA spacer is 20 nucleotides. of the guide RNA spacer is 23 nucleotides. In certain embodiments, the length of the guide RNA spacer is 25 nucleotides.
[00299] [00299] In certain embodiments, modulations of cleavage efficiency can be exploited by introducing mismatches, e.g. 1 or more mismatches, such as 1 or 2 mismatches between the spacer sequence and the target sequence, including the position of the mismatch along the spacer/target. The more central (ie not 3' or 5') eg a double mismatch, the greater the cleavage efficiency is affected. Therefore, by choosing the mismatch position along the spacer, the cleavage efficiency can be modulated. For example, if less than 100% cleavage of targets is desired (e.g. in a population of cells), 1 or more, preferably 2 mismatches between spacer and target sequence, can be introduced into the spacer sequences.
[00300] [00300] In certain exemplary embodiments, cleavage efficiency can be exploited to design unique guides that can distinguish two or more targets that vary by a single nucleotide, such as a single nucleotide polymorphism (SNP), variation, or (point) mutation. The CRISPR effector may have reduced sensitivity to SNPs (or other single nucleotide variations) and continue to cleave SNP targets with a certain level of efficiency.
[00301] [00301] In certain embodiments, the guide RNA is designed so that the SNP is located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 of the spacer sequence (starting at the 5' end). In certain embodiments, the guide RNA is designed so that the SNP is located at positions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the spacer sequence (starting at the 5' end).
[00302] [00302] In certain embodiments, the guide RNA is designed so that the mismatch (e.g. synthetic mismatch, i.e. an additional mutation in addition to an SNP) is located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 da spacer sequence (starting at the 5' end). In certain embodiments, the guide RNA is designed so that the mismatch is located at positions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the spacer sequence (starting at the 5' end). In certain embodiments, the guide RNA is designed so that the mismatch is located at positions 4, 5, 6, or 7 of the spacer sequence (starting at the 5' end). In certain embodiments, the guide RNA is designed so that the mismatch is located at positions 3, 4, 5 or 6 of the spacer, preferably at position 3. In certain embodiments, the guide RNA is designed so that the mismatch is located in the position 5 of the spacer sequence (starting at the 5' end).
[00303] [00303] In certain embodiments, said mismatch is 1, 2, 3, 4 or 5 nucleotides upstream or downstream, preferably 2 nucleotides, preferably downstream of said SNP or other single nucleotide variation in said guide RNA.
[00304] [00304] In certain embodiments, the guide RNA is designed so that the mismatch is located
[00305] [00305] In certain embodiments, the guide RNA is designed so that the mismatch is located 2 nucleotides downstream of the SNP (ie, one intervening nucleotide).
[00306] [00306] In certain embodiments, the guide RNA is designed so that the mismatch is located at position 5 of the spacer sequence (starting at the 5' end) and the SNP is located at position 3 of the spacer sequence (starting at the 5' end) .
[00307] [00307] In certain embodiments, the lead RNA comprises a spacer that is truncated from a wild-type spacer. In certain embodiments, the guide RNA comprises a spacer comprising less than 28 nucleotides, preferably between and including 20 to 27 nucleotides.
[00308] [00308] In certain embodiments, the guide RNA comprises a spacer consisting of 20-25 nucleotides or 20-23 nucleotides, preferably 20 or 23 nucleotides.
[00309] [00309] In certain embodiments, the one or more guide RNAs are designed to detect a single nucleotide polymorphism in a target RNA or DNA or in a splicing variant of an RNA transcript.
[00310] [00310] In certain embodiments, the one or more guide RNAs can be designed to bind to one or more target molecules that are diagnostic for a disease state. In one embodiment, the disease is cancer. In some embodiments, the immune disorder is an autoimmune disease. In some embodiments, the disease state may be an infection. In some embodiments, the infection may be caused by a virus, a bacterium, a fungus, a protozoan, or a parasite. In specific embodiments, the infection is a viral infection. In some embodiments, the viral infection is caused by a DNA virus.
[00311] [00311] The modalities described herein comprise inducing one or more nucleotide modifications in a eukaryotic cell (in vitro, i.e., in an isolated eukaryotic cell) as discussed herein comprising delivering a vector to the cell as discussed herein. The mutation(s) may include the introduction, deletion or substitution of one or more nucleotides in each cell target sequence(s) via the guide RNA(s). Mutations may include the introduction, deletion or substitution of 1-75 nucleotides in each target sequence of said cell(s) via the guide RNA(s).
[00312] [00312] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed to one or more Cas proteins) results in cleavage at or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs of the) target sequence, but may depend, for example, on secondary structure, in particular in the case of targets in RNA.
[00313] [00313] Example orthologs are provided in Table 8 below.
[00314] [00314] As used herein, a "detection construct" refers to a molecule that can be cleaved or inactivated by an activated CRISPR system effector protein described herein. The term "detection construct" may also be referred to in the alternative as "masking construct".
[00315] [00315] In certain exemplary embodiments, the masking construct may comprise an HCR primer sequence and a nick motif, or a cleavable structural element, such as a loop or hairpin, that prevents the primer from initiating the HCR reaction. The cleavage motif can be cut preferentially by one of the activated CRISPR effector proteins. After cleavage of the cleavage motif or framework element by an activated CRISPR effector protein, the primer is then released to trigger the HCR reaction, its detection indicating presence of one or more targets in the sample. In certain exemplary embodiments, the masking construct comprises a hairpin with an RNA loop. When an activated CRISPR effector protein cuts the RNA loop, the primer can be released to trigger the HCR reaction.
[00316] [00316] In certain exemplary embodiments, the masking construct may suppress the generation of a gene product. The gene product can be encoded by a reporter construct that is added to the sample. The masking construct can be an interfering RNA involved in an RNA interference pathway, such as a short hairpin RNA (shRNA) or a small interfering RNA ( siRNA). The masking construct may also comprise microRNA (miRNA). While present, the masking construct suppresses expression of the gene product. The gene product can be a fluorescent protein or other transcript or RNA proteins that would otherwise be detectable by a labeled probe, aptamer, or antibody, but by the presence of the masking construct.
[00317] [00317] In specific embodiments, the masking construct comprises a silencing RNA that suppresses the generation of a gene product encoded by a reporting construct, wherein the gene product generates the detectable positive signal when expressed.
[00318] [00318] In certain example embodiments, the masking construct may sequester one or more reagents necessary to generate a detectable positive signal, such that the release of one or more reagents from the masking construct results in the generation of the detectable positive signal. The one or more reagents may combine to produce a colorimetric signal, a chemiluminescent signal, a fluorescent signal, or any other detectable signal, and may comprise any reagents known to be suitable for such purposes. In certain exemplary embodiments, the one or more reagents are sequestered by RNA aptamers that bind to one or more reagents. The one or more reagents are released when the effector protein is activated upon detection of a target molecule and the RNA aptamers or DNA are degraded.
[00319] [00319] In certain exemplary embodiments, the masking construct may be immobilized on a solid substrate in an individual discrete volume (defined further below) and sequester a single reagent. For example, the reagent may be a granule comprising a dye. sequestered by the immobilized reagent, the individual beads are too diffuse to generate a detectable signal, but upon release of the masking construct they are capable of generating a detectable signal, for example, by aggregation or simple increase in solution concentration. In certain exemplary embodiments, the immobilized masking agent is an RNA or DNA-based aptamer that can be cleaved by the activated effector protein upon detection of a target molecule.
[00320] [00320] In certain other exemplary embodiments, the masking construct binds to a reagent immobilized in solution, thereby blocking the reagent's ability to bind to a separate labeled binding partner that is free in solution. Thus, after applying a wash step to a sample, the labeled binding partner can be washed out of the sample in the absence of a target molecule. However, if the effector protein is activated, the masking construct is cleaved to a sufficient degree to interfere with the masking construct's ability to bind the reagent, thus allowing the labeled binding partner to bind to the immobilized reagent. Thus, the labeled binding partner remains after the washing step, indicating the presence of the target molecule in the sample. In certain aspects, the masking construct that binds the immobilized reagent is a DNA or RNA aptamer. The immobilized reagent can be a protein and the labeled binding partner can be a labeled antibody. Alternatively, the immobilized reagent can be streptavidin and the labeled binding partner can be labeled as biotin. The tag on the binding partner used in the above embodiments can be any detectable tag known in the art. In addition, other known binding partners may be used in accordance with the general design described in this document.
[00321] [00321] In certain exemplary embodiments, the masking construct may comprise a ribozyme. Ribozymes are RNA molecules with catalytic properties. Ribozymes, both natural and engineered, comprise or consist of RNA that can be targeted by the effector proteins disclosed herein. The ribozyme can be selected or engineered to catalyze a reaction that generates a detectable negative signal or prevents the generation of a positive control signal. Upon deactivation of the ribozyme by the activated effector protein, the reaction that generates a negative control signal or prevents the generation of a detectable positive signal is removed, thus allowing a detectable positive signal to be generated. In an example embodiment, the ribozyme can catalyze a colorimetric reaction causing a solution to appear as a first color. When the ribozyme is inactivated, the solution changes to a second color, the second color being the detectable positive signal. An example of how ribozymes can be used to catalyze a colorimetric reaction is described in Zhao et al. “Signal amplification of glucosamine-6-phosphate based on ribozyme glmS,” Biosens Bioelectron. 2014; 16:337-42 and provides an example of how such a system might be modified to function in the context of the modalities disclosed herein. Alternatively, ribozymes, when present, can generate cleavage products, for example, RNA transcripts. Thus, detection of a detectable positive signal may comprise detection of uncleaved RNA transcripts that are generated only in the absence of the ribozyme.
[00322] [00322] In some embodiments, the masking construct may be a ribozyme that generates a detectable negative signal and wherein a detectable positive signal is generated when the ribozyme is inactivated.
[00323] [00323] In certain exemplary embodiments, the one or more reagents is a protein, such as an enzyme, capable of facilitating the generation of a detectable signal, such as a colorimetric, chemiluminescent, or fluorescent signal, which is inhibited or sequestered so that the protein cannot can generate the detectable signal by binding one or more DNA or RNA aptamers to the protein. Upon activation of the effector proteins disclosed herein, the DNA or RNA aptamers are cleaved or degraded to such an extent that they no longer inhibit the protein's ability to generate the detectable signal. In certain exemplary embodiments, the aptamer is a thrombin inhibitor aptamer. In certain exemplary embodiments, the thrombin inhibitor aptamer has a sequence of GGGAACAAAGCUGAAGUACUUACCC (SEQIDNO:310). When this aptamer is cleaved, thrombin becomes active and cleaves a colorimetric or fluorescent substrate from the peptide. In certain exemplary embodiments, the colorimetric substrate is para-nitroanilide (pNA) covalently linked to the thrombin peptide substrate. After thrombin cleavage, pNA is released and becomes yellow and easily visible to the eye. In certain exemplary embodiments, the fluorescent substrate is 7-amino-4-methylcoumarin, a blue fluorophore that can be detected using a fluorescence detector.
[00324] [00324] In certain embodiments, RNAse or DNAse activity is detected colorimetrically via cleavage of enzyme-inhibiting aptamers. A potential way to convert DNAse or RNAse activity into a colorimetric signal is to couple the cleavage of an aptamer of DNA or RNA to the reactivation of an enzyme capable of producing a colorimetric output. In the absence of RNA or DNA cleavage, the intact aptamer will bind to the enzyme target and inhibit its activity. The advantage of this reading system is that the enzyme provides an additional amplification step: once released from an aptamer through collateral activity (e.g. Cpf1 collateral activity), the colorimetric enzyme will continue to produce colorimetric product, leading to a multiplication of signal.
[00325] [00325] In certain embodiments, an existing aptamer that inhibits an enzyme with a colorimetric readout is used.
[00326] [00326] In certain embodiments, the masking construct may be a DNA or RNA aptamer and/or may comprise a DNA or RNA-bound inhibitor.
[00327] [00327] In certain embodiments, the masking construct may comprise a DNA or RNA oligonucleotide to which a detectable ligand and a masking component are linked.
[00328] [00328] In certain embodiments, RNAse or DNase activity is detected colorimetrically via cleavage of RNA-bound inhibitors. Many common colorimetric enzymes have reversible and competitive inhibitors: for example, beta-galactosidase can be inhibited by galactose. Many of these inhibitors are weak, but their effect can be enhanced by increasing the local concentration. By linking the local concentration of inhibitors to DNase RNAse activity, colorimetric enzyme and inhibitor pairs can be modified in DNase sensors and
[00329] [00329] In certain embodiments, the DNA or RNA-bound aptamer or inhibitor may sequester an enzyme, whereby the enzyme generates a detectable signal upon release of the DNA or RNA-bound aptamer or inhibitor acting on a substrate. In some embodiments, the aptamer may be an inhibitory aptamer that inhibits an enzyme and prevents the enzyme from catalyzing the generation of a detectable signal from a substance. In some embodiments, the inhibitor tied to DNA or RNA can inhibit an enzyme and can prevent the enzyme from catalyzing the generation of a detectable signal from a substrate.
[00330] [00330] In certain embodiments, RNAse activity is detected colorimetrically via formation and/or activation of G-quadruplexes. The G quadruplexes in DNA can complex with heme (iron(III)-proporoporphyrin IX) to form a DNAzyme with peroxidase activity. When supplied with peroxidase substrate (e.g. ABTS: (2,2'-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt)), the G-quadruplex-heme complex in the presence of hydrogen peroxide causes oxidation substrate, which then forms a green color in solution. An example of a DNA sequence that forms a G-quadruplex is: GGGTAGGGCGGGTTGGGA (SEQIDNO:311). By hybridizing an additional DNA or RNA sequence, referred to herein as a "clamp", to this DNA aptamer, formation of the G-quadraplex structure will be limited. Upon collateral activation, the staple will be cleaved, allowing the quadraplex G to form and heme to bind. This strategy is particularly attractive because color formation is enzymatic, which means that there is additional amplification in addition to collateral activation.
[00331] [00331] In certain embodiments, the masking construct may comprise an RNA oligonucleotide designed to bind a G-quadruplex forming sequence, wherein a G-quadruplex structure is formed by the G-quadruplex forming sequence following cleavage of the G-quadruplex. masking construct and in which the G-quadruplex structure generates a detectable positive signal.
[00332] [00332] In certain exemplary embodiments, the masking construct can be immobilized on a solid substrate in an individual discrete volume (defined further below) and sequester a single reagent. For example, the reagent may be a granule comprising a dye.
[00333] [00333] In an exemplary embodiment, the masking construct comprises a detection agent that changes color depending on whether the detection agent is aggregated or dispersed in solution. For example, certain nanoparticles, such as colloidal gold, undergo a visible purple to red color change as they pass from aggregates to dispersed particles. Therefore, in certain exemplary embodiments, such detection agents may be held together by one or more bridging molecules. At least a portion of the bridging molecule comprises RNA or DNA. Upon activation of the effector proteins disclosed herein, the RNA or DNA portion of the bridging molecule is cleaved, allowing the detection agent to disperse and resulting in the corresponding change in color. In certain exemplary embodiments, the detection agent is a colloidal metal. The colloidal metallic material may include water-insoluble metallic particles or metallic compounds dispersed in a liquid, a hydrosol or a metallic sol. Colloidal metal can be selected from the metals of groups IA, IB, IIB and IIIB of the periodic table, as well as transition metals, especially those of group VIII. Preferred metals include gold, silver, aluminum, ruthenium, zinc, iron, nickel and calcium. Other suitable metals also include the following in all their various oxidation states: lithium, sodium, magnesium, potassium, scandium, titanium, vanadium, chromium, manganese, cobalt, copper, gallium, strontium, niobium, molybdenum, palladium, indium, tin, tungsten, rhenium, platinum and gadolinium. The metals are preferably supplied in ionic form, derived from an appropriate metallic compound, for example Al3+, Ru3+, Zn2+, Fe3+, Ni2+ and Ca2+ ions.
[00334] [00334] When the RNA or DNA bridge is cut by the activated CRISPR effector, the color change mentioned above is observed. In certain exemplary embodiments, the particles are colloidal metals. In certain other exemplary embodiments, the colloidal metal is colloidal gold. In certain exemplary embodiments, the colloidal nanoparticles are 15 nm gold nanoparticles (AuNPs). Due to the unique surface properties of colloidal gold nanoparticles, the maximum absorbance is observed at 520 nm when fully dispersed in solution and with a red color to the naked eye. Upon aggregation of AuNPs, they exhibit a red shift at maximum absorbance and appear darker in color, eventually precipitating out of solution as a dark purple aggregate. In certain exemplary embodiments, the nanoparticles are modified to include DNA linkers that extend from the surface of the nanoparticle. Individual particles are linked together by single-stranded RNA (ssRNA) or single-stranded DNA bridges that hybridize at each end to at least a portion of the DNA linkers. Thus, the nanoparticles will form a network of bound and aggregated particles, appearing as a dark precipitate. Upon activation of the CRISPR effectors disclosed herein, the ssRNA or ssDNA bridge will be cleaved, releasing the AUNPS from the bound loop and producing a visible red color. Examples of DNA linkers and bridging sequences are listed below. The thiol linkers at the end of the DNA linkers can be used for surface conjugation with AuNPS.
[00335] [00335] In certain other exemplary embodiments, the masking construct may comprise an RNA or DNA oligonucleotide to which a detectable marker is linked and a masking agent for that detectable marker. An example of such a detectable label/masking agent pair is a fluorophore and a fluorophore inhibitor. Quenching of the fluorophore can occur as a result of the formation of a non-fluorescent complex between the fluorophore and another fluorophore or non-fluorescent molecule. This mechanism is known as ground state complex formation, static cooling, or contact cooling. Therefore, the RNA or DNA oligonucleotide can be designed so that the fluorophore and quencher are close enough together for contact cooling to occur. Fluorophores and their cognate inhibitors are known in the art and can be selected for that purpose by one skilled in the art. The specific fluorophore/quencher pair is not critical in the context of this invention, only that the selection of the fluorophore/quencher pairs ensures fluorophore masking. Upon activation of the effector proteins disclosed herein, the RNA or DNA oligonucleotide is cleaved, thereby severing the proximity between the fluorophore and the quencher necessary to maintain the contact quenching effect. Therefore, fluorophore detection can be used to determine the presence of a target molecule in a sample.
[00336] [00336] In certain other exemplary embodiments, the masking construct may comprise one or more RNA oligonucleotides to which one or more metal nanoparticles, such as gold nanoparticles, are attached.
[00337] [00337] In certain other exemplary embodiments, the masking construct may comprise one or more RNA or DNA oligonucleotides to which one or more quantum dots are linked. In some embodiments, cleavage of RNA or DNA oligonucleotides by the CRISPR effector protein leads to a detectable signal produced by the quantum dots.
[00338] [00338] In an example embodiment, the masking construct may comprise a quantum dot. The quantum dot may have several binding molecules attached to the surface. At least a portion of the linker molecule comprises RNA or DNA. The ligand molecule is attached to the quantum dot at one end and to one or more inhibitors along the length or at the terminal ends of the ligand so that the inhibitors are kept in close enough proximity for the quantum effect to occur. The linker may be branched. As above, the quantum dot/quencher pair is not critical, only this selection of the quantum dot/quencher pair guarantees fluorophore masking. Quantum dots and their cognate inhibitors are known in the art and can be selected for that purpose by one skilled in the art. Upon activation of the effector proteins disclosed herein, the RNA or DNA portion of the linker molecule is cleaved, thus eliminating the proximity between the quantum dot and one or more inhibitors necessary to maintain the inhibiting effect. In certain exemplary embodiments, the quantum dot is conjugated to streptavidin. RNA or DNA are ligated via biotin ligands and recruit quenching molecules with the sequences /5Biosg/UCUCGUACGUUC/3IAbRQSp/ (SEQIDNO:315) or /5Biosg/UCUCGUACGUUCUCUCGUACGUUC/3IAbRQSp/ (SEQIDNO:316) Where /5Biosg/ is a tag of biotin and /3lAbRQSp/ is a black fire extinguisher from Iowa. Upon cleavage, by the activated effectors disclosed herein, the quantum dot will visibly fluoresce.
[00339] [00339] In specific embodiments, the detectable ligand can be a fluorophore and the masking component can be a quencher molecule.
[00340] [00340] In a similar manner, fluorescence energy transfer (FRET) can be used to generate a detectable positive signal. FRET is a non-radiative process by which a photon from an energetically excited fluorophore (i.e., "donor fluorophore") raises the energy state of an electron in another molecule (i.e., "the acceptor") to higher vibrational levels of the state. excited singlet. The donor fluorophore returns to the ground state without emitting a fluorescence characteristic of that fluorophore. The acceptor can be another fluorophore or non-fluorescent molecule. If the acceptor is a fluorophore, the transferred energy is emitted as a fluorescence characteristic of that fluorophore. If the acceptor is a non-fluorescent molecule, the energy absorbed is loss as heat. Thus, in the context of the embodiments disclosed herein, the fluorophore/quencher pair is replaced by a fluorophore donor/acceptor pair linked to the oligonucleotide molecule. When intact, the masking construct generates a first signal (negative detectable signal) as detected by fluorescence or heat emitted by the acceptor. Upon activation of the effector proteins disclosed herein, the RNA oligonucleotide is cleaved and FRET is stopped so that the fluorescence of the donor fluorophore is now detected (positive detectable signal).
[00341] [00341] In certain exemplary embodiments, the masking construct comprises the use of intercalating dyes that change their absorbance in response to the cleavage of long RNAs or DNAs into short nucleotides.
[00342] [00342] In certain exemplary embodiments, the masking construct may comprise a primer for an HCR reaction. See, for example, Dirks and Pierce.
[00343] [00343] In certain exemplary embodiments, the masking construct suppresses the generation of a detectable positive signal until cleaved by an activated CRISPR effector protein. In some embodiments, the masking construct can suppress the generation of a detectable positive signal by masking the detectable positive signal or generating a detectable negative signal.
[00344] [00344] In certain example embodiments, target RNAs and/or DNAs may be amplified prior to activation of the CRISPR effector protein. Any suitable RNA or DNA amplification technique can be used. In certain exemplary embodiments, the RNA or DNA amplification is isothermal amplification. In certain exemplary embodiments, isothermal amplification can be nucleic acid sequence based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), amplification dependent helicase (HDA)) or enzymatic amplification reaction (NEAR). In certain exemplary embodiments, non-isothermal amplification methods may be used, which include, but are not limited to, PCR, multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or branch amplification (RAM).
[00345] [00345] In certain example embodiments, amplification of RNA or DNA is NASBA, which is initiated with reverse transcription of target RNA by a sequence-specific reverse primer to create an RNA/DNA duplex.
[00346] [00346] In certain other exemplary embodiments, a recombinase polymerase (RPA) amplification reaction may be used to amplify target nucleic acids. RPA reactions employ recombinases that are capable of pairing sequence-specific primers with homologous sequence in DNA duplexes. If target DNA is present, DNA amplification will be initiated and no further sample manipulation, such as thermal cycling or chemical melting, is required. The entire RPA amplification system is stable as a dry formulation and can be safely transported without refrigeration. RPA reactions can also be performed at isothermal temperatures with an optimal reaction temperature of 37-42°C. Sequence-specific primers are designed to amplify a sequence comprising the target nucleic acid sequence to be detected. In certain exemplary embodiments, an RNA polymerase promoter, such as a T7 promoter, is added to one of the primers. This results in an amplified double-stranded DNA product comprising the target sequence and an RNA polymerase promoter. After, or during the RPA reaction, an RNA polymerase is added that will produce RNA from the double-stranded DNA templates.
[00347] [00347] In one embodiment the invention may comprise nickase based amplification. The nicking enzyme may be a CRISPR protein. Therefore, the introduction of nicks into dsDNA can be programmable and sequence-specific.
[00348] [00348] Amplification can be isothermal and selected for temperature. In one embodiment, the amplification proceeds rapidly at 37 degrees. In other embodiments, the temperature of the isothermal amplification can be chosen by selecting a polymerase (eg, Bsu, Bst, Phi29, klenow fragment, etc.) operable at a different temperature.
[00349] [00349] Thus, when isothermal snipping amplification techniques use snipping enzymes with a fixed sequence preference (e.g. in the snipping enzyme amplification reaction or NEAR), which requires denaturing the original dsDNA target to allow for the annealing and the extension of primers that add the cutting substrate to the ends of the target, the use of a CRISPR nickase where the cutting sites can be programmed via guide RNAs means that no denaturation step is required, allowing the entire reaction to be carried out. truly isothermal. This also simplifies the reaction, because these primers that add the cutting substrate are different from the primers used later in the reaction, which means that NEAR requires two sets of primers (i.e., 4 primers), while Cpf1 amplification only requires a set of primers (ie, two primers). This makes Cpf1 amplification much simpler and easier to operate without complicated instrumentation to perform denaturation and then cool to isothermal temperature.
[00350] [00350] Therefore, in certain exemplary embodiments, the systems disclosed herein may include amplification reagents. Different components or reagents useful for amplifying nucleic acids are described here. For example, an amplification reagent as described herein may include a buffer, such as a Tris buffer. A Tris buffer can be used at any concentration appropriate for the application or desired use, for example, including but not limited to a concentration of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 25 mM, 50 mM, 75 mM, 1M or the like. One skilled in the art will be able to determine an appropriate concentration of a buffer, such as Tris, for use with the present invention.
[00351] [00351] A salt such as magnesium chloride (MgCl2), potassium chloride (KCl) or sodium chloride (NaCl) can be included in an amplification reaction such as PCR in order to improve the amplification of acid fragments nucleic acids. Although the salt concentration depends on the particular reaction and application, in some embodiments, nucleic acid fragments of a specific size can produce optimal results at specific salt concentrations.
[00352] [00352] Other components of a biological or chemical reaction may include a cell lysis component in order to open or lyse a cell for analysis of the materials contained therein. A cell lysis component may include, but is not limited to, a detergent, a salt as described above, such as NaCl, KCl, ammonium sulfate [(NH4)2SO4], or the like. Detergents that may be suitable for the invention may include Triton X-100, sodium dodecyl sulfate (SDS), CHAPS (3-[(3-
[00353] [00353] In some embodiments, amplification reagents as described herein may be suitable for use in hot start amplification. Hot start amplification may be beneficial in some embodiments to reduce or eliminate dimerization of adapter molecules or oligos, or to prevent unwanted amplification products or artifacts and achieve optimal amplification of the desired product. Many components described here for use in amplification can also be used in hot start amplification. In some embodiments, reagents or components suitable for use with hot-start amplification may be used in place of one or more of the components of the composition, as appropriate. For example, a polymerase or other reagent can be used that exhibits a desired activity at a specific temperature or other reaction condition. In some embodiments, reagents can be used that are designed or optimized for use in hot-start amplification, for example, a polymerase can be activated after transposition or after reaching a specific temperature. Such polymerases may be antibody-based or aptamer-based. Polymerases as described herein are known in the art. Examples of such reagents may include, but are not limited to, hot-start polymerases, hot-start dNTPs, and photoaging dNTPs. Such reagents are known and available in the art. One skilled in the art will be able to determine optimal temperatures as appropriate for individual reagents.
[00354] [00354] Nucleic acid amplification can be performed using specific thermal cycling machines or equipment, and can be performed in single reactions or in bulk, so that any desired number of reactions can be performed simultaneously. In some embodiments, amplification can be performed using microfluidic or robotic devices, or it can be performed using manual change in temperatures to achieve the desired amplification. In some embodiments, optimization can be performed to obtain optimal reaction conditions for the specific application or materials.
[00355] [00355] In certain embodiments, detection of DNA with the methods or systems of the invention requires transcription of the (amplified) DNA into RNA prior to detection.
[00356] [00356] It will be apparent that the detection methods of the invention may involve nucleic acid amplification and detection procedures in various combinations. The nucleic acid to be detected can be any synthetic or natural nucleic acid, including but not limited to DNA and RNA, which can be amplified by any suitable method to provide a detectable intermediate product. Detection of the intermediate product may be by any suitable method, including, but not limited to, binding and activating a CRISPR protein that produces a signal fraction detectable by direct or collateral activity.
[00357] [00357] In certain exemplary embodiments, the target RNA or DNA may first be enriched prior to detection or amplification of the target RNA or DNA. In certain exemplary embodiments, such enrichment may be achieved by binding the target nucleic acids by a CRISPR effector system.
[00358] [00358] Current target-specific enrichment protocols require single-stranded nucleic acid prior to hybridization with probes. Among several advantages, the present modalities can skip this step and allow direct targeting to double-stranded (partially or completely double-stranded) DNA. In addition, the modalities disclosed in this document are enzyme-driven targeting methods that offer faster kinetics and easier workflow, allowing for isothermal enrichment. In certain example embodiments, enrichment can occur at temperatures as low as 20-37o C. In certain example embodiments, a set of guide RNAs for different target nucleic acids is used in a single assay, allowing detection of multiple targets and /or multiple variants of a single target.
[00359] [00359] In certain exemplary embodiments, a killed CRISPR effector protein may bind to target nucleic acid in solution and then be isolated from said solution. For example, killed CRISPR effector protein bound to target nucleic acid can be isolated from solution using an antibody or other molecule, such as an aptamer, that specifically binds to the killed effective CRISPR protein.
[00360] [00360] In other example embodiments, the dead CRISPR effector protein can bind to a solid substrate.
[00361] [00361] A sample containing, or suspected of containing, the target nucleic acids can then be exposed to the substrate to allow binding of the target nucleic acids to the bound killed effective CRISPR protein. Non-target molecules can then be washed away. In certain exemplary embodiments, the target nucleic acids can then be released from the effector CRISPR protein/guide RNA Complex for further detection using the methods disclosed herein. In certain exemplary embodiments, target nucleic acids may first be amplified as described herein.
[00362] [00362] In certain example embodiments, the CRISPR effector may be labeled with a binding tag. In certain exemplary embodiments, the CRISPR effector may be chemically labeled. For example, the CRISPR effector can be chemically biotinylated. In another example embodiment, a fusion can be created by adding an additional sequence that encodes a fusion to the CRISPR effector. An example of such a fusion is AviTag™, which employs a highly targeted enzymatic conjugation of a single biotin to a single 15 amino acid peptide tag. In certain embodiments, the CRISPR effector may be labeled with a capture tag, such as, without limitation, GST, Myc, hemagglutinin (HA), green fluorescent protein (GFP), flag, His tag, TAP tag, and Fc tag. The binding tag, whether a fusion, chemical or capture tag, can be used to pull the CRISPR effector system once it has bound to a target nucleic acid or to attach the CRISPR effector system to the solid substrate.
[00363] [00363] In certain example embodiments, the guide RNA may be labeled with a binding tag. In certain exemplary embodiments, the entire guide RNA can be labeled using in vitro transcription (IVT) incorporating one or more biotinylated nucleotides, such as biotinylated uracil. In some embodiments, biotin can be added chemically or enzymatically to the guide RNA, such as the addition of one or more biotin groups to the 3' end of the guide RNA. The binding tag can be used to pull down the guide RNA/target nucleic acid complex after binding has occurred, for example by exposing the guide RNA/target nucleic acid to a solid substrate coated with streptavidin.
[00364] [00364] In specific embodiments, the solid substrate may be a flow cell. In certain embodiments, a flow cell may be a device for detecting the presence or amount of an analyte in a test sample. The flow cell device may have immobilized reagent means that produce an electrically or optically detectable response to an analyte that may be contained in a test sample.
[00365] [00365] Therefore, in certain exemplary embodiments, a projected or non-naturally occurring CRISPR effector may be used for enrichment purposes. In one embodiment, the modification may comprise mutating one or more amino acid residues of the effector protein. The one or more mutations may be in one or more catalytically active domains of the effector protein. The effector protein may have reduced or abolished nuclease activity compared to an effector protein without said one or more mutations. The effector protein may not direct RNA strand cleavage at the target locus of interest. In a preferred embodiment, the one or more mutations may comprise two mutations. In a preferred embodiment, the one or more amino acid residues are modified into a C2c2 effector protein, for example, a modified or unnatural or C2c2 effective protein. In particular embodiments, the one or more modified amino acid residues are one or more of those in C2c2 corresponding to R597, H602, R1278 and H1283 (with reference to the Lsh amino acids C2c2), such as the mutations R597A, H602A, R1278A and H1283A, or the corresponding amino acid residues in the Lsh C2c2 orthologs.
[00366] [00366] As such, the CRISPR enrichment system may comprise a catalytically inactive CRISPR effector protein. In specific embodiments, the catalytically inactive CRISPR effector protein is a catalytically inactive C2c2.
[00367] [00367] In particular embodiments, the one or more modified amino acid residues are one or more of those in C2c2 corresponding to K2, K39, V40, E479, L514, V518, N524, G534, K535, E580, L597, V602, D630, F676, L709, I713, R717 (HEPN), N718, H722 (HEPN), E773, P823, V828, I879, Y880, F884, Y997, L1001, F1009, L1013, Y1093, L1099, L1111, Y1114, L1203, D1222, Y1244, L1250, L1253, K1261, I1334, L1355, L1359, R1362, Y1366, E1371, R1372, D1373, R1509 (HEPN), H1514 (HEPN), Y1543, D1544, K1546, K1548, V1551, I1558 C2c2 consensus numbering. In certain embodiments, the one or more modified amino acid residues are one or more of those in C2c2 corresponding to R717 and R1509. In certain embodiments, the one or more modified amino acid residues are one or more of those in C2c2 corresponding to K2, K39, K535, K1261, R1362, R1372, K1546 and K1548. In certain embodiments, said mutations result in a protein that has an altered or modified activity. In certain embodiments, said mutations result in a protein with reduced activity, such as reduced specificity. In certain embodiments, said mutations result in a protein that lacks catalytic activity (i.e., "dead" C2c2).
[00368] [00368] The above enrichment systems can also be used to deplete a sample of certain nucleic acids. For example, guide RNAs can be designed to bind non-target RNAs to remove non-target RNAs from the sample. In an exemplary embodiment, guide RNAs can be designed to link nucleic acids that carry a particular nucleic acid variation. For example, in a given sample, a higher copy number of non-variant nucleic acids can be expected. Accordingly, the modalities disclosed herein can be used to remove non-variant nucleic acids from a sample to increase the efficiency with which the CRISPR effector detection system can detect target variant sequences in a given sample.
[00369] [00369] In certain exemplary embodiments, other modifications may be introduced that further amplify the detectable positive signal. For example, collateral activation of activated CRISPR effector protein can be used to generate a secondary target or an additional guide sequence, or both. In an example embodiment, the reaction solution would contain a secondary target that is spiked in high concentration.
[00370] [00370] The systems, devices and methods disclosed herein may also be adapted for detection of polypeptides (or other molecules), in addition to detection of nucleic acids, via incorporation of a specifically configured polypeptide detection aptamer. Polypeptide detection aptamers are distinct from the masking construct aptamers discussed above.
[00371] [00371] Accordingly, in certain exemplary embodiments, the methods disclosed herein comprise the additional step of distributing a sample or set of samples into a set of individual discrete volumes, each individual discrete volume comprising peptide detection aptamers, an effective CRISPR protein , one or more guide RNAs, a masking construct, and incubation of the sample or set of samples under conditions sufficient to allow binding of the detection aptamers to one or more target molecules, wherein binding of the aptamer to a corresponding target results in exposure of the RNA polymerase promoter binding site so that the synthesis of a trigger RNA is initiated by the binding of an RNA polymerase to the RNA polymerase promoter binding site.
[00372] [00372] In another example embodiment, the binding of the aptamer may expose a primer binding site after the binding of the aptamer to a target polypeptide. For example, the aptamer can expose a binding site to the RPA initiator.
[00373] [00373] In certain exemplary embodiments, the aptamer may be a conformational switch aptamer, which upon binding to the target of interest may alter the secondary structure and expose new regions of single-stranded DNA. In certain exemplary embodiments, these novel regions of single-stranded DNA can be used as substrates for ligation, extending the aptamers and creating longer ssDNA molecules that can be specifically detected using the modalities disclosed herein. The aptamer design could be further combined with ternary complexes for detection of low epitope targets such as glucose (Yang et al. 2015: http://pubs. acs.
[00374] [00374] The systems described here can be incorporated into diagnostic devices. A number of substrates and configurations can be used. Devices may be able to define multiple individual discrete volumes within the device. As used herein, an "individual discrete volume" refers to a discrete space, such as a container, receptacle, or other defined volume or space that can be defined by properties that prevent and/or inhibit the migration of target molecules, for example, a volume or space defined by physical properties, such as walls, e.g. the walls of a well, pipe, or the surface of a drop, which may be impermeable or semipermeable, or as defined by other means such as chemicals, limited diffusion rate, electromagnetic or light illumination or any combination thereof that may contain a sample within a defined space.
[00375] [00375] In some embodiments, the individual discrete volumes may be droplets.
[00376] [00376] In certain exemplary embodiments, the device comprises a substrate of flexible material on which a number of points can be defined. Flexible substrate materials suitable for use in diagnostics and biosensitivity are known in the art. Flexible substrate materials can be made from plant-derived fibers, such as cellulosic fibers, or they can be made from flexible polymers, such as flexible polyester films and other types of polymers. Within each defined point, the reagents of the system described here are applied to the individual points. Each spot can contain the same reagents, except for a different guide RNA or set of guide RNAs, or, where applicable, a different detection aptamer to screen multiple targets at the same time. Thus, the systems and devices described herein may be able to screen samples from multiple sources (e.g., multiple clinical samples from different individuals) for the presence of the same target, or a limited number of targets or aliquots from a single sample (or multiple samples). samples from the same source) for the presence of several different destinations in the sample. In certain exemplary embodiments, elements of the systems described herein are lyophilized on the paper or cloth substrate.
[00377] [00377] In some embodiments, a dosimeter or badge may be provided that serves as a sensor or indicator so that the user is notified of exposure to certain microbes or other agents. For example, the systems described herein can be used to detect a specific pathogen. Likewise, the aptamer-based modalities disclosed above can be used to detect both the polypeptide and other agents, such as chemical agents, to which a specific aptamer can bind.
[00378] [00378] In specific embodiments, each individual discrete volume further comprises one or more detection aptamers comprising a masked RNA polymerase promoter binding site or a masked primer binding site. As such, each individual discrete volume may further comprise nucleic acid amplification reagents.
[00379] [00379] In specific embodiments, the target molecule may be a target DNA and the individual discrete volumes further comprise a primer that binds the target DNA and comprises an RNA polymerase promoter.
[00380] [00380] Sample sources that can be analyzed using the systems and devices described herein include biological samples from a subject or environmental samples. Environmental samples can include surfaces or fluids. Biological samples may include, but are not limited to, saliva, blood, plasma, sera, feces, urine, sputum, mucosa, lymph, synovial fluid, spinal fluid, cerebrospinal fluid, a swab of skin or mucous membrane, or a combination thereof. In an exemplary embodiment, the environmental sample is taken from a solid surface, such as a surface used in food preparation or other sensitive materials and compositions.
[00381] [00381] In other exemplary embodiments, elements of the systems described herein may be placed on a single-use substrate such as a cotton swab or cloth that is used to rub a surface or sample of fluid.
[00382] [00382] Near real-time microbial diagnostics are needed for food, clinical, industrial, and other environmental environments (see, e.g., Lu TK, Bowers J, and Koeris MS., Trends Biotechnol.
[00383] [00383] In certain embodiments, the device is or comprises a flow band. For example, a lateral flow strip allows detection of RNAse (eg C2c2) by color. The RNA reporter is modified to have a first molecule (such as FITC) attached to the 5' end and a second molecule (such as biotin) attached to the 3' end (or vice versa). The lateral flow strip is designed to have two lines of capture with anti-first molecule antibodies (e.g. anti-FITC) hybridized in the first line and anti-second molecule antibodies (e.g. anti-biotin) in the second line downstream . As the reaction flows through the strip, uncleaved reporter binds to anti-first molecule antibodies in the first capture line, while cleaved reporters release the second molecule and allow the second molecule to bind in the second capture line. Second molecule sandwich antibodies, for example conjugated to nanoparticles such as gold nanoparticles, bind any second molecule in the first or second row and result in a strong readout/signal (e.g. color). As more reporter is cleaved, more signal accumulates in the second capture line and less signal appears in the first line. In certain aspects, the invention pertains to the use of a track below as described herein for the detection of nucleic acids or polypeptides. In certain aspects, the invention pertains to a method for detecting nucleic acids or polypeptides with a flux range as defined herein, for example, flow (lateral) tests or flow (lateral) immunochromatographic assays.
[00384] [00384] The modalities disclosed in this document are directed to lateral flow detection devices that comprise SHERLOCK systems. The device may comprise a lateral flow substrate for detecting a SHERLOCK reaction. Substrates suitable for use in lateral flow assays are known in the art.
[00385] [00385] Side support substrates can be located inside a housing (see eg "Fast Side Flow Test Strips" Merck Millipore 2013). The housing may comprise at least one opening for loading samples and a single second opening or separate openings that allow reading of the detectable signal generated in the first and second capture regions.
[00386] [00386] The SHERLOCK system can be lyophilized on the side-flow substrate and packaged as a ready-to-use device, or the SHERLOCK system can be added to the reagent portion of the side-flow substrate at the time of use of the device. The samples to be screened are loaded onto the sample loading portion of the side-flow substrate. Samples should be liquid samples or samples dissolved in an appropriate solvent, usually aqueous.
[00387] [00387] Specific binding integrator molecules comprise any binding pair members that can be used in the present invention. Such binding pairs are known to those skilled in the art and include, but are not limited to, antibody-antigen pairs, enzyme-substrate pairs, receptor-ligand pairs, and streptavidin-biotin. In addition to these known binding pairs, new binding pairs can be specifically designed. A characteristic of binding pairs is the bonding between the two members of the binding pair.
[00388] [00388] Oligonucleotide linkers that have molecules at each end may comprise DNA if the CRISPR effective protein has DNA collateral activity (Cpf1 and C2c1) or RNA if the CRISPR effective protein has RNA collateral activity. Oligonucleotide linkers can be single-stranded or double-stranded and, in certain embodiments, they can contain regions of RNA and DNA. Oligonucleotide linkers can be of varying lengths, such as 5-10 nucleotides, 10-20 nucleotides, 20-50 nucleotides, or more.
[00389] [00389] In some embodiments, the polypeptide identifier elements include affinity tags such as hemagglutinin (HA) tags, Myc tags, FLAG tags, V5 tags, chitin binding protein (CBP) tags, binding protein tags maltose (MBP), GST tags, poly tags - Your tags and fluorescent proteins (e.g., green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), dsRed, mCherry, Kaede, Kindling and derivatives thereof, FLAG tags, Myc tags, AU1 tags, T7 tags, OLLAS tags, Glu-Glu tags, VSV tags, or a combination thereof. Other affinity tags are well known in the art. Such tags can be detected and/or isolated using methods known in the art (e.g., using specific binding agents, such as antibodies, that recognize a particular affinity tag). Such specific binding agents (e.g., antibodies) may and still contain, for example, detectable labels such as isotopic labels and/or nucleic acid barcodes such as those described herein.
[00390] [00390] For example, a lateral flow strip allows detection of RNAse (eg Cas13a) by color.
[00391] [00391] In certain exemplary embodiments, a lateral flow device comprises a lateral flow substrate comprising a first end for application of a sample. The first region is loaded with a detectable linker, such as those disclosed herein, for example, a gold nanoparticle.
[00392] [00392] In certain example embodiments, the device is a microfluidic device that generates and/or merges different droplets (ie, individual discrete volumes). For example, a first set of droplets may be formed containing samples to be screened and a second set of droplets formed containing elements of the systems described herein. The first and second set of droplets are then merged and then the diagnostic methods described here are performed on the merged droplet set. The microfluidic devices disclosed herein may be silicon-based chips and may be manufactured using a variety of techniques, including, but not limited to, hot stamping, elastomer molding, injection molding, alloying, soft lithography, silicon fabrication, and fabrication techniques. related thin film processing. Suitable materials for manufacturing the microfluidic devices include, but are not limited to, cyclic olefin copolymer (COC), polycarbonate, poly(dimethylsiloxane) (PDMS) and poly(methylacrylate) (PMMA).
[00393] [00393] In certain example embodiments, the system and/or device can be adapted for conversion to a flow cytometry readout or allow all quantitative and sensitive measurements of millions of cells in a single experiment and enhance methods based on existing flow, such as the PrimeFlow assay. In certain exemplary embodiments, cells can be molded into droplets containing unpolymerized gel monomer, which can then be molded into single-cell droplets suitable for analysis by flow cytometry. A detection construct comprising a fluorescent detectable label can be dropped into the drop comprising unpolymerized gel monomer. After polymerization of the gel monomer to form a bead within a droplet.
[00394] [00394] An example of a microfluidic device that can be used in the context of the invention is described in Hour et al. “Direct Detection and drug-resistance profiling of bacteremias using inertial microfluidics” Lap Chip. 15(10):2297-2307 (2016).
[00395] [00395] In the systems described herein, it can further be incorporated into wearable medical devices that assess biological samples, such as biological fluids, from a subject outside the clinical setting and report the test result remotely to a central server accessible by a healthcare professional . The device may include the ability to auto-sampling blood, such as devices disclosed in Patent Application Publication US2015/0342509 entitled “Needle-free Blood Draw by Peeters et al., Patent Application Publication
[00396] [00396] In some embodiments, the individual distinct volumes are microwells.
[00397] [00397] In certain exemplary embodiments, the device may comprise individual wells, such as microplate wells. The size of the microplate wells can be the size of standard size 6, 24, 96, 384, 1536, 3456 or 9600 wells. In certain exemplary embodiments, elements of the systems described herein can be lyophilized and applied to the surface of the microplate. well before distribution and use.
[00398] [00398] The devices disclosed herein may further comprise inlet and outlet holes or openings which, in turn, can be connected to valves, tubes, channels, chambers and syringes and/or pumps for introducing and extracting fluids into and out of the device. The devices can be connected to fluid flow actuators that allow directional movement of fluids within the microfluidic device. Examples of actuators include, but are not limited to, syringe pumps, mechanically driven recirculation pumps, electroosmotic pumps, lamps, bellows, diaphragms, or bubbles intended to force fluid movement. In certain exemplary embodiments, the devices are connected to controllers with programmable valves that work together to move fluids through the device. In certain example embodiments, devices are connected to controllers discussed in more detail below. Devices can be connected to flow actuators, controllers, and sample loading devices via tubes that terminate in metal studs for insertion into the device's inlet ports.
[00399] [00399] As shown here, the elements of the system are stable when lyophilized, therefore, embodiments that do not require a support device are also contemplated, i.e., the system can be applied to any surface or fluid that supports the reactions disclosed herein and allow detection of a detectable positive signal from that surface or solution. In addition to lyophilization, the systems can also be stored stably and used in a pelleted form. Polymers useful in forming suitable pelletized forms are known in the art.
[00400] [00400] In some embodiments, individual distinct volumes are defined on a solid substrate. In some embodiments, the individual distinct volumes are defined points on a substrate. In some embodiments, the substrate may be a substrate of flexible materials, for example, including, but not limited to, a paper substrate, a fabric substrate, or a polymer-based flexible substrate. In specific embodiments, the substrate of flexible materials is a paper substrate or a polymer-based flexible substrate.
[00401] [00401] In certain embodiments, the CRISPR effector protein is bound to each discrete volume in the device. Each discrete volume may comprise a different guide RNA, specific to a different target molecule. In certain embodiments, a sample is exposed to a solid substrate comprising more than a discrete volume each comprising a guide RNA specific to a target molecule. Not being bound by a theory, each guide RNA will capture its target molecule from the sample and the sample will not need to be split into separate assays. Thus, a valuable sample can be preserved. The effector protein may be a fusion protein comprising an affinity tag. Affinity tags are well known in the art (eg, HA tag, Myc tag, Flag tag, His tag, biotin).
[00402] [00402] The devices disclosed herein may also include elements of point-of-care (POC) devices known in the art for analyzing samples by other methods. See, for example, St John and Price, “Existing and Emerging Technologies for Point-of-Care Testing” (Clin Biochem Rev. 2014Aug; 35 (3): 155-167).
[00403] [00403] The present invention can be used with a wireless laboratory-on-chip (LOC) diagnostic sensor system (see, for example, patent number US9,470,699 "Radio Frequency Diagnostic Sensors and Applications thereof"). In certain embodiments, the present invention is performed at a LOC controlled by a wireless device (e.g., a cell phone, a personal digital assistant (PDA), a tablet) and the results are reported to said device.
[00404] [00404] Radio Frequency Identification (RFID) tag systems include an RFID tag that transmits data for reception by an RFID reader (also known as an interrogator). In a typical RFID system, individual objects (eg store merchandise) are equipped with a relatively small tag that contains a transponder. The transponder has a memory chip that receives an electronic code unique to the product. The RFID reader emits a signal by activating the transponder inside the tag through the use of a communication protocol. Therefore, the RFID reader is able to read and write data on the tag. In addition, the RFID tag reader processes the data according to the RFID tag system application. Currently, there are passive and active RFID tags. The passive type RFID tag does not contain an internal power source, but is powered by radio frequency signals received from the RFID reader. Alternatively, the active-type RFID tag contains an internal power supply that allows the active-type RFID tag to have greater transmission ranges and memory capacity. The use of a passive tag versus an active tag depends on the specific application.
[00405] [00405] Lab-on-the-chip technology is well described in the scientific literature and consists of multiple microfluidic channels, inlet wells, or chemicals. The reactions in the wells can be measured using radio frequency identification (RFID) technology, as the conductive conductors of the RFID electronic chip can be directly linked to each of the test wells. An antenna can be printed or mounted on another layer of the electronic chip or directly on the back of the device.
[00406] [00406] In preferred embodiments, the LOC may be a microfluidic device. OLOC can be a passive chip, where the chip is powered and controlled via a wireless device. In certain embodiments, the LOC includes a microfluidic channel for holding reagents and a channel for introducing a sample. In certain embodiments, a signal from the wireless device supplies power to the LOC and activates mixing of the sample and assay reagents.
[00407] [00407] As surface area electrical conductivity can be measured, accurate quantitative results are possible in disposable wireless RFID electroassays. Also, the test area can be very small, allowing more tests to be done in a given area and therefore resulting in cost savings. In certain embodiments, separate sensors, each associated with a different CRISPR effector protein and guide RNA immobilized on a sensor, are used to detect multiple target molecules. Not being limited by a theory, the activation of different sensors can be differentiated by the wireless device.
[00408] [00408] In addition to the conductive methods described in this document, other methods can be used that rely on RFID or Bluetooth as a low-cost basic communication and power platform for a disposable RFID assay. For example, optical means can be used to assess the presence and level of a given target molecule. In certain embodiments, an optical sensor detects the unmasking of a fluorescent masking agent.
[00409] [00409] In certain embodiments, the device of the present invention may include handheld devices for reading diagnostics from an assay (see, for example, Vashist et al., Commercial Smartphone-Based Devices and Smart Apps for Personalized Healthcare Monitoring and Management , Diagnostics 2014, 4(3), 104-128; Mobile Assay mReader; and Holomic Rapid Diagnostic Test Reader).
[00410] [00410] As noted in this document, certain modalities allow detection via colorimetric change which has certain associated benefits when the modalities are used in POC situations and or in resource-poor environments where access to more complex detection equipment to read the signal may be limited. However, portable modalities disclosed in this document can also be coupled to portable spectrophotometers that allow detection of signals outside the visible range. An example of a portable spectrophotometer device that can be used in combination with the present invention is described in Das et al. “Ultra-portable, wireless smartphone spectrophotometer for rapid, non-destructive testing of fruit ripeness. ” Nature Scientific Reports. 2016, 6:32504, DOI: 10. 1038/srep32504.
[00411] [00411] The low cost and adaptability of the test platform lends itself to various applications, including (i) RNA/DNA/protein quantification, (ii) rapid, multiplexed RNA/DNA and protein expression detection, and (iii) of nucleic acids, peptides and target proteins in clinical and environmental samples. Furthermore, the systems disclosed herein may be adapted for detecting transcripts within biological settings, such as cells. Given the highly specific nature of the CRISPR effectors described herein, it may be possible to screen for allelic-specific expression of disease-associated transcripts or mutations in living cells.
[00412] [00412] In some embodiments, the methods include detecting target nucleic acids in samples, comprising dispensing a sample or set of samples into one or more individual discrete volumes, comprising a CRISPR system, as described herein. The sample or set of samples can then be incubated under conditions sufficient to allow binding of one or more guide RNAs to one or more target molecules, and the CRISPR effector protein can be activated by binding one or more guide RNAs to that or more target molecules. target molecules, where activation of the CRISPR effector protein results in the modification of the RNA-based masking construct such that a detectable positive signal is generated. The one or more detectable positive signals can then be detected, with the detection indicating the presence of one or more target molecules in the sample.
[00413] [00413] In some embodiments, methods of the invention include detecting polypeptides in samples, comprising dispensing a sample or set of samples into a set of individual volumes comprising peptide detection aptamers and a CRISPR system as described herein. The sample or set of samples can then be incubated under conditions sufficient to allow binding of the peptide detection aptamers to one or more target molecules, wherein binding of the aptamer to a corresponding target molecule exposes the RNA polymerase binding site or the primer binding site resulting in the generation of a trigger RNA. The RNA effector protein can then be activated through the binding of one or more guide RNAs to the trigger RNA, whereby activation of the RNA effector protein results in the modification of the RNA-based masking construct such that a detectable positive signal is obtained. produced. The detectable positive signal can then be detected, with detection of the detectable positive signal indicating the presence of one or more target molecules in a sample.
[00414] [00414] In certain example embodiments, a single target-specific guide sequence is placed in separate volumes. Each volume can then receive a different sample or aliquot of the same sample. In certain example embodiments, multiple guide sequences, each to separate the target, can be placed in a single well, so that multiple targets can be tracked in a different well. In order to detect multiple guide RNAs in a single volume, in certain example modalities, multiple effector proteins with different specificities can be used.
[00415] [00415] In the embodiments, different orthologs with different sequence specificities may be used. Crop motifs can be used to take advantage of the sequence specificities of different orthologs. The masking construct may comprise a nick motif cut preferentially by a Cas protein. A sequence of cutting motifs can be a specific nucleotide base, a nucleotide base repeated in a homopolymer or a heteropolymer of bases. The cleavage motif can be a dinucleotide sequence, a trinucleotide sequence or more complex motifs comprising 4, 5, 6, 7, 8, 9 or 10 nucleotide motifs. For example, one ortholog may preferentially cleave A, while others preferentially cleave C, G, U/T. Accordingly, masking constructs can be generated that fully comprise, or comprise a substantial portion, of a single nucleotide, each with a different fluorophore that can be detected at different wavelengths.
[00416] [00416] In addition to single base editing preferences, additional detection constructs can be designed based on other motive cut preferences of the Cas13 and Cas12 orthologs. For example, the Cas13 or Cas12 orthologs may preferentially cut a dinucleotide sequence, a trinucleotide sequence or more complex motifs comprising 4, 5, 6, 7, 8, 9 or 10 nucleotide motifs. As an example, LwaCas13a showed strong preference for hexanucleotide motif sequences, with CcaCas13b showing strong preference for other hexanucleotide motifs, as shown in FIG. 89D.
[00417] [00417] As demonstrated here, CRISPR effector systems are capable of detecting atmolar concentrations of target molecules. See, for example, FIGs. 13, 14, 19, 22 and the Working Examples described below. Due to the sensitivity of said systems, various applications that require rapid and sensitive detection can benefit from the modalities disclosed in this document and are contemplated as being within the scope of the invention. Sample assays and applications are described in more detail below.
[00418] [00418] In specific embodiments, the target molecule may be a target DNA and the method may further comprise ligating the target DNA to a primer comprising an RNA polymerase site, as described herein.
[00419] [00419] In specific embodiments, the one or more guide RNAs can be designed to detect a single nucleotide polymorphism in a target RNA or DNA or in a splicing variant of an RNA transcript.
[00420] [00420] Specific modalities involve amplifying sample RNA or trigger RNA as described here.
[00421] [00421] A sample for use with the invention may be a biological or environmental sample, such as a food sample (fresh fruits or vegetables, meats), a beverage sample, a paper surface, a fabric surface, a fabric, a metal surface, a wooden surface, a plastic surface, a soil sample, a freshwater sample, a waste water sample, a saline water sample, exposure to atmospheric air or to another gas sample or a combination of them. For example, home/commercial/industrial surfaces made of any material, including but not limited to metal, wood, plastic, rubber or the like, can be scrubbed and tested for contaminants. Soil samples can be tested for the presence of pathogenic bacteria or parasites or other microbes, both for environmental purposes and for testing on humans, animals or plants. Water samples such as fresh water samples, wastewater samples or saline water samples can be evaluated for cleanliness and safety, and/or potability, to detect the presence of, for example, Cryptosporidium parvum, Giardia lamblia or other microbial contamination.
[00422] [00422] In some embodiments, the one or more guide RNAs can be designed to bind to cell-free nucleic acids. In some embodiments, the one or more guide RNAs can be designed to detect a single nucleotide polymorphism in a target RNA or DNA or in a splicing variant of an RNA transcript. In some embodiments, the one or more guide RNAs are designed to bind to one or more target molecules that are diagnostic for a disease state, as described above.
[00423] [00423] In some embodiments, the disease state can be an infection, an organ disease, a blood disease, an immune system disease, a cancer, a brain and nervous system disease, an endocrine disease, a disease related to pregnancy or childbirth, an inherited disease, or an environmentally acquired disease.
[00424] [00424] In certain exemplary embodiments, the systems, devices, and methods disclosed herein are directed to detecting the presence of one or more microbial agents in a sample, such as a biological sample obtained from a subject. In certain exemplary embodiments, the microbe can be a bacterium, a fungus, a yeast, a protozoan, a parasite, or a virus. Accordingly, the methods disclosed herein can be adapted for use in other methods (or in combination) with other methods that require rapid identification of microbial species, monitoring the presence of microbial proteins (antigens), antibodies, antibody genes, detection of certain phenotypes (bacterial resistance), monitoring of disease progression and/or outbreak, and antibiotic screening.
[00425] [00425] A method for identifying microbial species, such as bacterial, viral, fungal, yeast or parasite species, or the like is disclosed. Particular embodiments disclosed in this document describe methods and systems that will identify and distinguish microbial species in a single sample or in multiple samples, allowing the recognition of many different microbes.
[00426] [00426] Multiplexed sample analysis allows large-scale sample detection, reducing analysis time and cost. However, multiplex analyzes are often limited by the availability of a biological sample. In accordance with the invention, however, alternatives to multiplex analysis can be performed so that multiple effector proteins can be added to a single sample and each masking construct can be combined with a separate quencher dye. In this case, positive signals from each extinguishing dye can be obtained separately for multiple detection in a single sample.
[00427] [00427] Disclosed herein are methods for distinguishing between two or more species of one or more organisms in a sample. The methods are also capable of detecting one or more species of one or more organisms in a sample.
[00428] [00428] In some embodiments, the methods provide for the detection of disease states that are characterized by the presence or absence of a gene or transcript or polypeptide or antibiotic or drug resistance, preferably in a pathogen or cell.
[00429] [00429] In certain embodiments, the method may further comprise comparing the detectable positive signal with a synthetic standard signal, as for example illustrated in an exemplary embodiment in FIG. 60, and as is described in detail here elsewhere.
[00430] [00430] In some embodiments, a method is provided for detecting microbes in samples comprising dispensing a sample or set of samples into one or more individual discrete volumes, the individual discrete volumes comprising a CRISPR system as described herein; incubating the sample or set of samples under conditions sufficient to allow binding of one or more guide RNAs to one or more specific microbial targets; activating the CRISPR effector protein by binding one or more guide RNAs to one or more target molecules, wherein activation of the CRISPR effector protein results in the modification of the RNA-based masking construct such that a detectable positive signal is generated; and detecting the detectable positive signal, wherein detection of the detectable positive signal indicates the presence of one or more target molecules in the sample. The one or more target molecules can be mRNA, gDNA (coding or non-coding), trRNA or RNA comprising a target nucleotide chain sequence that can be used to distinguish two or more microbial species/strains from one another. Guide RNAs can be designed to detect target sequences. The modalities disclosed herein may also utilize certain steps to improve hybridization between the guide RNA and target RNA sequences. Methods for improving ribonucleic acid hybridization are disclosed in WO2015/085194, entitled "Improved Methods of Hybridization with Ribonucleic Acid", which is incorporated herein by reference. The specific target for microbes can be RNA or DNA or a protein. If the DNA method may further comprise the use of DNA primers that introduce an RNA polymerase promoter as described herein. If the target is a protein, the method will use aptamers and specific steps for the detection of proteins described herein.
[00431] [00431] In some embodiments, one or more identified target sequences can be detected using guide RNAs that are specific and bind to the target sequence, as described here. The systems and methods of the present invention can even distinguish between single nucleotide polymorphisms (SNPs) present between different microbial species and therefore the use of various guide RNAs according to the invention can further expand or improve the number of target sequences. that can be used to distinguish between species. For example, in some embodiments, the one or more guide RNAs can distinguish between microbes in the species, genus, family, order, class, phylum, kingdom, or phenotype, or a combination thereof.
[00432] [00432] In certain exemplary embodiments, the devices, systems and methods disclosed herein may be used to distinguish various microbial species in a sample. In certain exemplary embodiments, identification may be based on ribosomal RNA sequences, including the 16S, 23S, and 5S subunits. Methods for identifying relevant rRNA sequences are disclosed in patent application publication US2017/0029872. In certain exemplary embodiments, a set of guide RNAs can be designed to distinguish each species by a variable region that is unique to each species or strain. Guide RNAs can also be designed to target RNA genes that distinguish microbes across genera, family, order, class, phylum, kingdom levels, or a combination thereof.
[00433] [00433] In certain example modalities, a method or diagnosis is designed to screen microbes across multiple phylogenetic and/or phenotypic levels at the same time. For example, the method or diagnosis may comprise the use of multiple CRISPR systems with different guide RNAs. A first set of guide RNAs can distinguish, for example, between mycobacteria, gram-positive and gram-negative bacteria. These general classes can be further subdivided. For example, guide RNAs can be designed and used in the method or diagnosis that distinguishes enteric and non-enteric within gram-negative bacteria. A second set of guide RNAs can be designed to distinguish microbes at the genus or species level. Thus, a matrix can be produced identifying all mycobacteria, gram-positive and gram-negative (divided into enteric and non-enteric) with each genus of bacterial species identified in a given sample that fall into one of these classes. The foregoing is for example purposes only. Other means of classifying other types of microbes are also contemplated and would follow the general structure described above.
[00434] [00434] In certain exemplary embodiments, the devices, systems and methods disclosed herein can be used to screen for microbial genes of interest, for example, antibiotics and/or antiviral resistance genes.
[00435] [00435] Ribavirin is an effective antiviral that targets various RNA viruses. Several clinically important viruses have evolved resistance to ribavirin, including the foot-and-mouth disease virus doi:10. 1128/JVI. 03594-13; polio virus ( Pfeifer and Kirkegaard. PNAS, 100 (12): 7289-7294, 2003 ); and hepatitis C virus ( Pfeiffer and Kirkegaard, J. Virol. 79(4):2346-2355, 2005 ). Several other persistent RNA viruses, such as hepatitis and HIV, have developed resistance to existing antiviral drugs: hepatitis B virus (lamivudine, tenofovir, entecavir) doi: 10/1002/hep22900; hepatitis C virus (telaprevir, BILN2061, ITMN-191, SCh6, boceprevir, AG-021541, ACH-806) doi: 10.1002/hep. 22549; and HIV (many drug resistance mutations) hivb. standford. education The modalities disclosed in this document can be used to detect these variants among others.
[00436] [00436] In addition to drug resistance, there are several clinically relevant mutations that can be detected with the modalities disclosed herein, such as persistent versus acute infection in LCMV (doi: 10.1073/pnas.
[00437] [00437] As described elsewhere herein, closely related microbial species (eg, having only a single nucleotide difference in a given target sequence) can be distinguished by introducing a synthetic mismatch into the gRNA.
[00438] [00438] In particular embodiments, a set of guide RNAs is designed that can identify, for example, all microbial species within a defined set of microbes. In certain exemplary embodiments, methods for generating guide RNAs as described herein may be compared to methods disclosed in WO2017/040316, incorporated herein by reference. As described in WO2017040316, a pool coverage solution can identify the minimum number of target sequence probes or guide RNAs needed to cover an entire target sequence or a set of target sequences, for example a set of genomic sequences. Set coverage approaches have previously been used to identify microarray primers and/or probes, typically in the range of 20 to 50 base pairs. See, for example, Pearson et al., cs. Virginia.
[00439] [00439] In contrast, the modalities disclosed in this document are aimed at detecting longer probe or guide RNA lengths, eg in the range of 70 bp to 200 bp that are suitable for hybrid selection sequencing.
[00440] [00440] The ability to detect multiple transcriptional abundances may allow the generation of unique microbial signatures indicative of a specific phenotype. Various machine learning techniques can be used to derive gene signatures.
[00441] [00441] In one aspect of the invention, a method comprises detecting one or more pathogens. In this way, differentiation between infection of a subject by individual microbes can be obtained. In some modalities, this differentiation may allow detection or diagnosis by a clinician of specific diseases, for example, different variants of a disease.
[00442] [00442] In some embodiments, a CRISPR system or methods of using the same, as described here, may be used to determine the course of a pathogen outbreak. The method may comprise detecting one or more target sequences from a plurality of samples from one or more subjects, wherein the target sequence is a sequence from a microbe causing the outbreaks. This method may further comprise determining a pathogen transmission pattern or a mechanism involved in a disease outbreak caused by a pathogen.
[00443] [00443] The pattern of pathogen transmission may comprise continued new transmissions from the natural reservoir of the pathogen or subject-to-subject transmissions (eg, human-to-human transmission) after a single transmission from the natural reservoir or a mixture of both. In one embodiment, transmission of the pathogen may be bacterial or viral transmission; in that case, the target sequence is preferably a microbial genome or fragments thereof. In one embodiment, the pattern of pathogen transmission is the initial pattern of pathogen transmission, that is, at the beginning of the pathogen outbreak. Determining the pattern of pathogen transmission early in the outbreak increases the likelihood of stopping the outbreak as early as possible, thus reducing the possibility of local and international spread.
[00444] [00444] Determining the pattern of transmission of pathogens may comprise detection of a sequence of pathogens in accordance with the methods described herein. Determining the pattern of pathogen transmission may further comprise detecting shared intra-host variations of the pathogen sequence between subjects and determining whether shared intra-host variations show temporal patterns. Patterns in observed intrahost and interhost variation provide important information about transmission and epidemiology (Gire, et al., 2014).
[00445] [00445] The detection of shared intra-host variations between individuals that show temporal patterns is an indication of transmission links between individuals (in particular between humans) because it can be explained by the infection of the individual from various sources (superinfection), recurrent mutations in sample contamination (with or without balancing selection to reinforce mutations) or co-transmission of slightly divergent viruses that arose by mutation earlier in the chain of transmission (Park et al.,Cell 161(7):1516–1526 , 2015). Detection of intra-host variations shared between subjects may comprise detection of intra-host variants located at common single nucleotide polymorphism (SNP) positions.
[00446] [00446] Like the Ebola virus, the Lassa virus (LASV) can cause hemorrhagic fever with high mortality rates. Andersen et al. generated a genomic catalog of nearly 200 LASV sequences from clinical samples and rodent reservoirs (Andersen, et al., Cell Volume 162, Issue 4, p 738-750, Aug. 13, 2015).
[00447] [00447] The method may further comprise determining whether the mutations are deleterious or adaptive. Deleterious mutations are indicative of viruses impaired in transmission and dead-end infections, therefore normally present only in an individual. Mutations unique to an individual are those that occur in the outer branches of the phylogenetic tree, while mutations in the inner branches are those that are present in multiple samples (that is, in multiple individuals). Higher non-synonymous replacement rate is a feature of the outer branches of the phylogenetic tree (Park, et al., 2015).
[00448] [00448] In the inner branches of the phylogenetic tree, selection had more opportunity to filter out deleterious mutants. Internal branches, by definition, have produced multiple descendant lines and are therefore less likely to include mutations with fitness costs. Thus, lower non-synonymous substitution rate is indicative of internal ramifications (Park,
[00449] [00449] Synonymous mutations, which are likely to have less impact on fitness, occurred at more comparable frequencies in the inner and outer branches (Park, et al., 2015).
[00450] [00450] By analyzing the sequenced target sequence, such as viral genomes, it is possible to discover the mechanisms responsible for the severity of the epidemic episode, such as during the Ebola outbreak in 2014. For example, Gire et al.
[00451] [00451] It has also been possible to determine how the Lassa virus spread from its point of origin, in particular thanks to human-to-human transmission, and even retrace the history of this spread 400 years ago (Andersen, et al., Cell 162). (4):738–50, 2015).
[00452] [00452] Regarding the work required during the 2013–2015 EBOV outbreak and the difficulties encountered by medical staff at the outbreak site, and more generally, the method of the invention makes it possible to perform sequencing using fewer selected probes, so that sequencing can be accelerated, thus reducing the time required from sample collection to results. In addition, kits and systems can be designed to be field usable so that a patient's diagnoses can be easily performed without the need to ship or send samples to another part of the country or the world.
[00453] [00453] In any method described above, the sequencing of the target sequence or fragment thereof may be used in any of the sequencing procedures described above. Furthermore, sequencing of the target sequence or its fragment can be near real-time sequencing. The sequencing of the target sequence or fragment thereof can be performed according to the methods described above (Experimental Procedures: Matranga et al., 2014; and Gire, et al., 2014). Sequencing the target sequence or fragment thereof may comprise parallel sequencing of a plurality of target sequences. Sequencing the target sequence or fragment thereof may comprise Illumina sequencing.
[00454] [00454] Analysis of the target sequence or fragment thereof that hybridizes to one or more of the selected probes may be an identification analysis, in which the hybridization of a selected probe to the target sequence or a fragment thereof indicates the presence of the sequence target in the sample.
[00455] [00455] Currently, the primary diagnosis is based on the symptoms that a patient presents. However, several diseases can share identical symptoms, so the diagnosis relies heavily on statistics. For example, malaria triggers flu-like symptoms: headache, fever, tremors, joint pain, vomiting, hemolytic anemia, jaundice, hemoglobin in the urine, retinal damage, and seizures. These symptoms are also common for septicemia, gastroenteritis, and viral illnesses. Among the latter, Ebola hemorrhagic fever has the following symptoms: fever, sore throat, muscle aches, headache, vomiting, diarrhea, rash, decreased liver and kidney function, internal and external bleeding.
[00456] [00456] When a patient is presented to a medical facility, for example in tropical Africa, the basic diagnosis ends up with malaria, because statistically, malaria is the most likely disease in that region of Africa. Consequently, the patient is treated for malaria, although they may not have actually contracted the disease and end up not being treated properly. This lack of correct treatment can be fatal, especially when the disease contracted by the patient has a rapid evolution. It may be too late for the medical team to realize that the treatment given to the patient is ineffective and arrive at the correct diagnosis and administer the appropriate treatment to the patient.
[00457] [00457] The method of the invention provides a solution to this situation. In fact, as the number of guide RNAs can be drastically reduced, this makes it possible to provide selected probes on a single chip, divided into groups, each group being specific for a disease, so that a plurality of diseases, such as viral infection, can be diagnosed at the same time. Thanks to the invention, more than 3 diseases can be diagnosed on a single chip, preferably more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 diseases at the same time, preferably diseases that occur most commonly in the population of a given geographic area. As each group of probes selected is specific to one of the diagnosed diseases, a more accurate diagnosis can be made, decreasing the risk of administering the wrong treatment to the patient.
[00458] [00458] In other cases, an illness such as a viral infection may occur without symptoms or have caused symptoms but disappeared before the patient is presented to the medical team. In these cases, the patient does not seek medical attention or the diagnosis is complicated due to the absence of symptoms on the day of presentation.
[00459] [00459] The present invention can also be used in conjunction with other methods of diagnosing diseases, identifying pathogens and optimizing treatment based on the detection of nucleic acids such as mRNA in crude and unpurified samples.
[00460] [00460] The method of the invention also provides a powerful tool to resolve this situation. In fact, since a plurality of groups of selected guide RNAs, each group being specific for one of the most common diseases that occur in the population of a certain area, is composed of a single diagnosis, the medical team only needs to contact a biological sample taken from the patient with the chip. The chip reading reveals the diseases that the patient has contracted.
[00461] [00461] In some cases, the patient is presented to the medical team for diagnosis of specific symptoms. The method of the invention makes it possible not only to identify which disease causes these symptoms, but at the same time to determine whether the patient suffers from another disease of which he was not aware.
[00462] [00462] This information can be of utmost importance when looking for the mechanisms of an outbreak. Indeed, groups of patients with identical viruses also show temporal patterns, suggesting subject-to-subject transmission links.
[00463] [00463] In certain exemplary embodiments, the CRISPR systems disclosed herein may be used to screen for microbial genetic disorders. Such methods can be useful, for example, for mapping microbial pathways and functional networks. Microbial cells can be genetically modified and then screened under different experimental conditions. As described above, the modalities disclosed herein can screen multiple target molecules in a single sample or a single target in a single discrete volume in a multiplex manner. Genetically modified microbes can be modified to include a nucleic acid barcode sequence that identifies the specific genetic modification performed by a specific microbial cell or population of microbial cells. A barcode is a short sequence of nucleotides (eg DNA, RNA or combinations thereof) that is used as an identifier. A nucleic acid barcode can be 4-100 nucleotides in length and be single-stranded or double-stranded. Methods for identifying cells with barcodes are known in the art. Therefore, the guide RNAs from the CRISPR effector systems described herein can be used to detect the barcode. The detection of the positive detectable signal indicates the presence of a specific genetic modification in the sample.
[00464] [00464] In certain exemplary embodiments, the methods may be used to track hypomorphs. The generation of hypomorphs and their use in the identification of key bacterial functional genes and in the identification of new antibiotic therapies, as disclosed in PCT/US2016/060730 entitled "High resolution multiplex detection of microorganism strains, related kits, diagnostic methods and assays Screening" filed November 4, 2016, which is incorporated herein by reference.
[00465] [00465] Different experimental conditions may include exposure of microbial cells to different chemical agents, combinations of chemical agents, different concentrations of chemical agents or combinations of chemical agents, different durations of exposure to chemical agents or combinations of chemical agents, different parameters physical or both. In certain exemplary embodiments, the chemical agent is an antibiotic or antiviral. Different physical parameters to be tracked may include different temperatures, atmospheric pressures, different atmospheric and non-atmospheric concentrations of gases, different pH levels, different compositions of culture media or a combination thereof.
[00466] [00466] The methods disclosed herein may also be used to screen environmental samples for contaminants by detecting the presence of target nucleic acid or polypeptides. For example, in some embodiments, the invention provides a method for detecting microbes, comprising: exposing a CRISPR system as described herein to a sample; activating an RNA effector protein by binding one or more guide RNAs to one or more microbe-specific target RNAs or one or more trigger RNAs so that a detectable positive signal is produced. The positive signal can be detected and is indicative of the presence of one or more microbes in the sample. In some embodiments, the CRISPR system may be on a substrate as described herein, and the substrate may be exposed to the sample. In other embodiments, the same CRISPR system, and/or a different CRISPR system can be applied to multiple discrete locations on the substrate. In other embodiments, the different CRISPR system may detect a different microbe at each location. As described in more detail above, a substrate may be a substrate of flexible materials, for example, including but not limited to a paper substrate, a fabric substrate or a polymer-based flexible substrate.
[00467] [00467] In accordance with the invention, the substrate may be passively exposed to the sample by temporarily immersing the substrate in a fluid to be sampled, applying a fluid to be tested to the substrate, or by contacting a surface to be tested with the substrate. . Any means of introducing the sample to the substrate may be used as appropriate.
[00468] [00468] As described herein, a sample for use with the invention can be a biological or environmental sample, such as a food sample (fresh fruits or vegetables, meats), a beverage sample, a paper surface, a fabric surface , a metal surface, a wooden surface, a plastic surface, a soil sample, a freshwater sample, a wastewater sample, a saline water sample, exposure to atmospheric air or to another gas sample or a combination of them. For example, home/commercial/industrial surfaces made of any material, including but not limited to metal, wood, plastic, rubber or the like, can be scrubbed and tested for contaminants. Soil samples can be tested for the presence of pathogenic bacteria or parasites or other microbes, both for environmental purposes and for testing on humans, animals or plants. Water samples such as fresh water samples, wastewater samples or saline water samples can be evaluated for cleanliness and safety, and/or potability, to detect the presence of, for example, Cryptosporidium parvum, Giardia lamblia or other microbial contamination.
[00469] [00469] In some embodiments, verification of food contamination by bacteria, such as E. coli, in restaurants or other food suppliers; food surfaces; Water test for pathogens such as Salmonella, Campylobacter or E. coli; also checking food quality by manufacturers and regulators to determine the purity of meat sources; identify air contamination with pathogens such as legionella; Check whether the beer is contaminated or spoiled by pathogens such as Pediococcus and Lactobacillus; contamination of pasteurized or unpasteurized cheese by bacteria or fungi during manufacture.
[00470] [00470] A microbe according to the invention may be a pathogenic microbe or a microbe that results in spoilage of food or consumables. A pathogenic microbe can be pathogenic or undesirable to humans, animals or plants. For human or animal purposes, a microbe can cause disease or result in disease. Animal or veterinary applications of the present invention can identify animals infected with a microbe. For example, the methods and systems of the invention can identify companion animals with pathogens, including but not limited to kennel cough, rabies virus and heartworms. In other embodiments, the methods and systems of the invention can be used for parentage testing for breeding purposes. A plant microbe can result in damage or disease to a plant, reduction in yield or change characteristics such as color, taste, consistency, odor, for purposes of contamination of food or consumables, a microbe can adversely affect taste, odor, color and consistency or other commercial properties of the food or consumable. In certain exemplary embodiments, the microbe is a bacterial species. The bacterium can be a psychotrophic, a coliform, a lactic acid bacterium or a spore-forming bacterium. In certain exemplary embodiments, the bacterium can be any bacterial species that causes disease or illness or results in an undesirable product or tract. Bacteria according to the invention can be pathogenic for humans, animals or plants.
[00471] [00471] Samples suitable for use in the methods disclosed herein include any conventional biological sample obtained from an organism or part thereof, such as a plant, animal, bacterium and the like. In particular embodiments, the biological sample is obtained from an animal subject, such as a human subject. A biological sample is any solid or liquid sample obtained, excreted or secreted by any living organism, including, without limitation, single-celled organisms such as bacteria, yeasts, protozoa and amoebas, among others, multicellular organisms (such as plants or animals, including samples of a healthy or apparently healthy human subject or a human patient affected by a condition or disease to be diagnosed or investigated, such as an infection by a pathogenic microorganism, such as pathogenic bacteria or viruses). For example, a biological sample can be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucosa, lymphatic fluid, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid , aqueous or vitreous humor or any bodily secretions, a transudate, an exudate (for example, fluid obtained from an abscess or any other site of infection or inflammation) or fluid obtained from a joint (for example, a normal joint or an affected joint disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis) or a swab from the surface of the skin or mucous membrane.
[00472] [00472] A sample can also be a sample obtained from any organ or tissue (including a biopsy or autopsy sample, such as a tumor biopsy) or can include a cell (either a primary cell or a cultured cell) or a conditioned medium by any cell, tissue or organ. Examples of samples include, without limitation, cells, cell lysates, blood smears, cytocentrifuge preparations, cytology smears, body fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.) , tissue biopsies (tumor biopsies), fine needle aspirates, and/or tissue sections (eg, cryostat tissue sections and/or paraffin-embedded tissue sections). In other examples, the sample includes circulating tumor cells (which can be identified by cell surface markers). In particular examples, samples are used directly (e.g. fresh or frozen) or may be manipulated prior to use, e.g. by fixation (e.g. using formalin) and/or wax embedding (such as tissue samples soaked in paraffin and formalin fixed (FFPE)). It will be appreciated that any method of obtaining tissue from a subject can be used and that the selection of the method used will depend on a number of factors, such as tissue type, age of the subject, or procedures available to the practitioner. Standard techniques for acquiring such samples are available in the art. See, for example, Schluger et al., J. Exp. Med. 176:1327-33 (1992); Bigby et al., Am. Rev. Breathe. Dis. 133:515-18 (1986); Kovacs et al., NEJM318:589-93 (1988); and Ognibene et al., Am. Rev.
[00473] [00473] In other embodiments, a sample may be an environmental sample such as water, soil, or a surface such as an industrial or medical surface. In some embodiments, methods such as those disclosed in patent publication US2013/0190196 can be applied to the detection of nucleic acid signatures, specifically RNA levels, directly from crude cell samples with a high degree of sensitivity and specificity. The specific sequences for each pathogen of interest can be identified or selected by comparing the coding sequences of the pathogen of interest with all the coding sequences in other organisms by the BLAST software.
[00474] [00474] Various embodiments of the present disclosure involve the use of procedures and approaches known in the art to successfully fractionate clinical blood samples. See, for example, the procedure described in Han Wei Hour et al., Microfluidic Devices for Blood Fractionation, Micromachines 2011, 2, 319-343 ; Ali Asgar S.
[00475] [00475] In addition, various embodiments of the present disclosure involve using procedures and approaches known in the art to successfully isolate pathogens from whole blood using spiral microchannel, as described in Han Wei Hour et al., Isolation of whole blood pathogens using spiral microchannel, Case 15995JR, Massachusetts Institute of Technology, manuscript in preparation, the disclosure of which is incorporated herein by reference in its entirety.
[00476] [00476] Due to the increased sensitivity of the modalities disclosed herein, in certain exemplary embodiments, the assays and methods may be performed on raw samples or samples in which the target molecules to be detected are no longer fractionated or purified from the sample.
[00477] [00477] The modality disclosed herein can be used to detect a number of different microbes. The term microbe as used herein includes bacteria, fungi, protozoa, parasites and viruses.
[00478] [00478] The following is a list of examples of the types of microbes that can be detected using the modalities disclosed in this document.
[00479] [00479] In certain exemplary embodiments, the microbe is a fungus or a species of fungus. Examples of fungi that can be detected according to the disclosed methods include, without limitation, any one or more of (or any combination of), Aspergillus, Blastomyces, Candidiasis, Coccidiodomycosis, Cryptococcus neoformans, Cryptococcus gatti, sp. Histoplasma sp. (as Histoplasma capsulatum), Pneumocystis sp. (such as Pneumocystis jirovecii), Stachybotrys (such as Stachybotrys chartarum), Mucromycosis, Sporothrix, Mycosis fungal eye infections, Exserohilum, Cladosporium.
[00480] [00480] In certain exemplary embodiments, the fungus is a yeast. Examples of yeasts that can be detected according to the disclosed methods include, without limitation, one or more of (or any combination of) Aspergillus species (such as Aspergillus fumigatus, Aspergillus flavus and Aspergillus clavatus), Cryptococcus sp. (such as Cryptococcus neoformans, Cryptococcus gattii, Cryptococcus laurentii and Cryptococcus albidus), a species of Geotrichum, a species of Saccharomyces, a species of Hansenula, a species of Candida (such as Candida albicans), a species of Kluyveromyces, a species of Debaryomyces, a species of Debaryomyces, or a combination thereof. In certain exemplary embodiments, the fungi is a mold. Examples of molds include, but are not limited to, a Penicillium species, a Cladosporium species, a Byssochlamys species, or a combination thereof.
[00481] [00481] In certain exemplary embodiments, the microbe is a protozoan. Examples of protozoa that can be detected according to the disclosed methods and devices include, without limitation, any one or more of (or any combination of), Euglenozoa, Heterolobosea, Diplomonadida, Amoebozoa, Blastocystic and Apicomplexa.
[00482] [00482] In certain exemplary embodiments, the microbe is a parasite. Examples of parasites that can be detected according to the disclosed methods include, without limitation, one or more of (or any combination of), Trypanosoma cruzi (Chagas disease), T. brucei gambiense, T. brucei rhodesiense, Leishmania braziliensis, L.
[00483] [00483] In specific embodiments, examples of parasites include members of the Onchocerca and Plasmodium species.
[00484] [00484] In certain exemplary embodiments, the systems, devices, and methods disclosed herein are directed at detecting viruses in a sample. The modalities disclosed herein can be used to detect viral infection (e.g., of a subject or plant) or determination of a viral strain, including viral strains that differ by a single nucleotide polymorphism. The virus can be a DNA virus, an RNA virus, or a retrovirus. Non-limiting examples of viruses useful with the present invention include, but are not limited to, Ebola, measles, SARS, Chikungunya, hepatitis, Marburg, yellow fever, MERS, Dengue, Lassa, influenza, rhabdovirus, or HIV. A hepatitis virus can include hepatitis A, hepatitis B or hepatitis C. An influenza virus can include, for example, influenza A or influenza B.
[00485] [00485] In certain exemplary embodiments, the virus may be a plant virus selected from the group comprising tobacco mosaic virus (TMV), tomato wilt virus (TSWV), cucumber mosaic virus (CMV) , potato virus Y (PVY), RTC cauliflower mosaic virus (CaMV), plum virus (PPV), Brome mosaic virus (BMV), potato virus X (PVX), citrus tristeza virus (CTV), barley yellow dwarf virus (BYDV), potato leaf virus (PLRV), tomato bush stunt virus (TBSV), tungro rice spherical virus (RTSV), rice yellow spot virus (RYMV) , rice hoja blanca virus (RHBV), fine streak maize virus (MRFV), maize dwarf mosaic virus (MDMV), sugar cane mosaic virus (SCMV), sweet potato seed virus (SPFMV) , sweet potato sunken vein lock virus (SPSVV), grapevine leaf virus (GFLV), grapevine A virus (GVA), grapevine A virus (GVA), grapevine B virus (GVB), from the stain of grapevine (GFkV), vine leafroll-associated virus-1, -2 and -3 (GLRaV-1, -2 and -3), Arabis mosaic virus (ArMV) or Rupestris stem-bite-associated virus (RSPaV) .
[00486] [00486] In certain exemplary embodiments, the virus may be a retrovirus. Examples of retroviruses that can be detected using the modalities disclosed herein include one or more of or any combination of viruses of the genus Alpharetrovirus, Betaretrovirus, Gammaretrovirus, Deltaretrovirus, Epsilonretrovirus, Lentivirus, Spumavirus or Family Metaviridae, Pseudoviridae and HIVRetroviridae (including Retroviridae)), Hepadnaviridae (including hepatitis B virus) and Caulimoviridae (including cauliflower mosaic virus).
[00487] [00487] In certain embodiments of the example, the virus is a DNA virus. Examples of DNA viruses that can be detected using the modalities disclosed herein include one or more (or any combination of) viruses from the Family Myoviridae, Podoviridae, Siphoviridae, Alloherpesviridae,
[00488] [00488] Malaria is a disease transmitted by mosquitoes caused by Plasmodium parasites. The parasites are transmitted to people through the bites of infected female Anopheles mosquitoes. Five species of Plasmodium cause malaria in humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. Among them, according to the World Health Organization (WHO), Plasmodium falciparum and Plasmodium vivax are responsible for the greatest threat. P.
[00489] [00489] In 2015, 91 countries and areas maintained continuous malaria transmission. According to the latest WHO estimates, there were 212 million cases of malaria in 2015 and 429,000 deaths. In areas with high malaria transmission, children under age 5 are particularly susceptible to infection, illness and death; more than two-thirds (70%) of all malaria deaths occur in this age group. Between 2010 and 2015, the under-5 mortality rate fell by 29% worldwide. However, malaria remains the leading cause of death for children under five, taking the life of a child every two minutes.
[00490] [00490] As described by the WHO, malaria is an acute febrile illness. In a non-immune individual, symptoms appear 7 days or more after the bite of the infected mosquito. The first symptoms - fever, headache, chills and vomiting - can be mild and difficult to recognize as malaria; however, if not treated within 24 hours, P. falciparum malaria can progress to serious illness, often leading to death.
[00491] [00491] Children with severe malaria often develop one or more of the following symptoms: severe anemia, respiratory distress in relation to metabolic acidosis, or cerebral malaria. In adults, multiple organ involvement is also common. In malaria-endemic areas, people can develop partial immunity, allowing asymptomatic infections to occur.
[00492] [00492] The development of rapid and efficient diagnostic tests is of high public health relevance. Indeed, early diagnosis and treatment of malaria not only reduce the disease and prevent deaths,
[00493] [00493] Resistance to antimalarial therapies represents a critical health problem that drastically reduces therapeutic strategies. In fact, as reported on the WHO website, P.
[00494] [00494] In this context, the WHO Global Technical Strategy for Malaria 2016-2030 - adopted by the World Health Assembly in May 2015 - provides a technical framework for all malaria-endemic countries. It is intended to guide and support regional and national programmes,
[00495] [00495] This strategy was the result of an extensive consultative process that lasted 2 years and involved the participation of over 400 technical experts from 70 Member States. It is based on 3 main axes: • ensuring universal access to malaria prevention, diagnosis and treatment; • accelerate efforts to eliminate and achieve malaria-free status; and • transform malaria surveillance into a core intervention.
[00496] [00496] Treatment against Plasmodium includes aryl-amino alcohols such as quinine or quinine derivatives such as chloroquine, amodiaquine, mefloquine,
[00497] [00497] Target sequences that are diagnostic for the presence of a mosquito-borne pathogen include sequences that are diagnostic for the presence of Plasmodium, especially species of Plasmodia species affecting humans such as Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium knowlesi, including their genome sequences.
[00498] [00498] Target sequences that are diagnostic for monitoring drug resistance to treatment against Plasmodium, mainly Plasmodia species that affect humans such as Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium knowlesi.
[00499] [00499] Additional target sequences include sequences include target molecules/nucleic acid molecules that code for proteins involved in the essential biological process for the Plasmodium parasite and primarily carrier proteins such as drug/metabolite carrier family proteins, the protein-binding cassette protein ATP (ABC) involved in substrate translocation, such as the ABC transporter subfamily or the Na +/H + exchanger, membrane glutathione S-transferase; proteins involved in the folate pathway, such as dihydropteroate synthase, dihydrofolate reductase activity or dihydrofolate reductase-thymidylate synthase; and proteins involved in the translocation of protons across the inner mitochondrial membrane and mainly the cytochrome b complex. Additional targets may also include the gene(s) encoding heme polymerase.
[00500] [00500] Other target sequences include target molecules/nucleic acid molecules that encode proteins involved in the essential biological process can be selected from the P. falciparum chloroquine resistance transporter gene (pfcrt), multidrug resistance transporter 1 to P. falciparum (pfmdr1), P. falciparum multidrug resistance-associated protein gene (Pfmrp), P. falciparum Na+/H+ exchanger gene (pfnhe), the gene encoding protein 1 exported by P. falciparum, the Ca2+ of P falciparum carrying ATPase 6 (pfatp6); the P. falciparum dihydropteroate synthase genes (pfdhps), dihydrofolate reductase activity (pfdhpr) and dihydrofolate reductase thymidylate synthetase (pfdhfr) genes, the cytochrome b gene, the P. cytochrome b, the cyclo-gtp
[00501] [00501] A number of mutations, notably single-point mutations, have been identified in the proteins that are the targets of current treatments and associated with specific resistance phenotypes. Therefore, the invention allows for the detection of various resistance phenotypes of mosquito-borne parasites such as plasmodium.
[00502] [00502] The invention makes it possible to detect one or more mutations and notably one or more single nucleotide polymorphisms in target core acids/molecules. Therefore, any of the mutations below, or their combination thereof, can be used as a drug resistance marker and can be detected in accordance with the invention.
[00503] [00503] Single point mutations in P. falciparum K13 include the following single point mutations at positions 252, 441, 446, 449, 458, 493, 539, 543, 553, 561, 568, 574, 578, 580, 675 , 476, 469, 481, 522, 537, 538, 579, 584 and 719 and in particular the mutations E252Q, P441L, F446I, G449A, N458Y, Y493H, R539T, I543T, P553L, R561H, V568G, P574L, C A578YS A675V, M476I; C469Y; A481V; S522C; N537I; N537D; G538V; M579I; D584V; and H719N. These mutations are usually associated with the drug resistance phenotypes of artemisinins (artemisinin and artemisinin-based combination therapy resistance, April 2016WHO/HTM/GMP/2016.5).
[00504] [00504] In P. falciparum dihydrofolate reductase (DHFR) (PfDHFR-TS, PFD0830w), important polymorphisms include mutations at positions 108, 51, 59 and 164, notably 108D, 164L, 51I and 59R, which modulate resistance to pyrimethamine. Other polymorphisms also include 437G, 581G, 540E, 436A and 613S, which are associated with sulfadoxine resistance. Additional observed mutations include Ser108Asn, Asn51Ile, Cys59Arg, Ile164Leu, Cys50Arg, Ile164Leu, Asn188Lys, Ser189Arg and Val213Ala, Ser108Thr and Ala16Val. Ser108Asn, Asn51Ile, Cys59Arg, Ile164Leu, Cys50Arg, Ile164Leu mutations are notably associated with pyrimethamine-based therapy and/or resistances to chloroguanine-dapsone combination therapy. Cycloguanyl resistance appears to be associated with the Ser108Thr and Ala16Val double mutations. Dhfr amplification may also be of high relevance for therapy resistance, notably pyrimethamine resistance.
[00505] [00505] In the dihydropteroate synthase of P.
[00506] [00506] In the P. falciparum chloroquine resistance transporter (PfCRT), the polymorphism at position 76, notably the Lys76Thr mutation, is associated with chloroquine resistance. Other polymorphisms include Cys72Ser, Met74Ile, Asn75Glu, Ala220Ser, Gln271Glu, Asn326Ser, Ile356Thr and Arg371Ile that may be associated with chloroquine resistance. OPfCRT is also phosphorylated at residues S33, S411 and T416, which can regulate transport activity or protein specificity.
[00507] [00507] On the multi-resistant conveyor to P.
[00508] [00508] In P. falciparum multidrug resistance-associated protein (PfMRP) (gene reference PFA0590w), polymorphisms at positions 191e/or 437, such as Y191H and A437S, have been identified and associated with chloroquine resistance phenotypes.
[00509] [00509] In P. falciparum NA+/H+ exchanger (PfNHE) (ref PF13_0019), increased repeat DNNND in ms4670 microsatellite may be a marker for quinine resistance.
[00510] [00510] Mutations that alter the ubiquinol binding site of the cytochrome b protein encoded by the cytochrome b gene (cytb, mal_mito_3) are associated with atovaquone resistance. Mutations at positions 26, 268, 276, 133 and 280 and notably Tyr26Asn, Tyr268Ser, M1331 and G280D may be associated with atovaquone resistance.
[00511] [00511] For example, in PVivax, mutations in PvMDR1, the homolog of Pf MDR1, have been associated with chloroquine resistance, mainly polymorphism at position 976, such as the Y976F mutation.
[00512] [00512] The above mutations are defined in terms of protein sequences. However, the skilled person is able to determine the corresponding mutations, including SNPS, to be identified as a target nucleic acid sequence.
[00513] [00513] Other identified drug resistance markers are known in the art, for example, as described in "Susceptibility of Plasmodium falciparum to antimalarial drugs (1996–2004)"; WHO; Artemisinin and artemisinin-based combination therapy resistance (April 2016WHO/HTM/GMP/2016.5); “Drug-resistant malaria: molecular mechanisms and implications for public health” FEBSLett. 2011Jun 6;585(11):1551-62. two:10. 1016/j.
[00514] [00514] As for the polypeptides that can be detected according to the present invention, gene products from all genes mentioned herein can be used as targets. Accordingly, it is contemplated that such polypeptides may be used for species identification, typing, and/or drug resistance detection.
[00515] [00515] In certain exemplary embodiments, the systems, devices, and methods disclosed herein are directed to detecting the presence of one or more mosquito-borne parasites in a sample, such as a biological sample obtained from a subject. In certain exemplary embodiments, the parasite may be selected from the species Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae or Plasmodium knowlesi. Accordingly, the methods disclosed herein can be adapted for use in other methods (or in combination) with other methods that require rapid identification of parasite species, monitoring the presence of parasites and parasite forms (e.g., corresponding to various stages of infection). infection and parasite life cycle, such as exo-erythrocytic cycle, erythrocytic cycle, sporpogonic cycle; parasite forms, including merozoites, sporozoites, schizonts, gametocytes); detection of certain phenotypes (eg, resistance to the pathogenic drug), monitoring of disease progression and/or outbreak, and treatment (drug) tracking. Furthermore, in the case of malaria, a long time may elapse after the infectious bite, that is, a long incubation period, during which the patient has no symptoms. Likewise, prophylactic treatments can delay the onset of symptoms, and long asymptomatic periods can also be seen before a relapse. Such delays can easily cause misdiagnosis or delay in diagnosis and thus impair the effectiveness of treatment.
[00516] [00516] Due to the rapid and sensitive diagnostic capabilities of the modalities disclosed herein, detection of parasite type, down to a single nucleotide difference, and the ability to be implanted as a POC device, the modalities disclosed herein can be used as therapeutic regimens guide, such as selecting the appropriate course of treatment. The modalities disclosed in this document can also be used to screen environmental samples (mosquito population, etc.) for the presence and typing of the parasite. The modalities can also be modified to detect mosquito-borne parasites and other mosquito-borne pathogens simultaneously. In some cases, malaria and other mosquito-borne pathogens may initially show similar symptoms. Thus, the ability to quickly distinguish the type of infection can guide important treatment decisions. Other mosquito-borne pathogens that can be detected in conjunction with malaria include dengue, West Nile virus, chikungunya, yellow fever, filariasis, Japanese encephalitis, Saint Louis encephalitis, western equine encephalitis, eastern equine encephalitis, Venezuelan equine encephalitis, La Crosse, and Zika.
[00517] [00517] In certain exemplary embodiments, the devices, systems, and methods disclosed herein may be used to distinguish various species of mosquito-borne parasites in a sample. In certain exemplary embodiments, identification may be based on ribosomal RNA sequences, including the 18S, 16S, 23S, and 5S subunits. In certain exemplary embodiments, identification may be based on gene sequences that are present in multiple copies in the genome,
[00518] [00518] In certain example embodiments, species identification can be performed based on genes that are present in multiple copies in the genome, such as mitochondrial genes like CYTB. In certain exemplary embodiments, species identification can be performed on the basis of highly expressed expressions. and/or highly conserved genes such as GAPDH, Histone H2B, enolase or LDH.
[00519] [00519] In certain example modalities, a method or diagnosis is designed to screen mosquito-borne parasites through multiple phylogenetic and/or phenotypic levels at the same time. For example, the method or diagnosis may comprise the use of multiple CRISPR systems with different guide RNAs. A first set of guide RNAs can distinguish, for example, between Plasmodium falciparum or Plasmodium vivax. These general classes can be further subdivided. For example, guide RNAs can be designed and used in the method or diagnosis that distinguishes drug-resistant strains, in general or with respect to a specific drug or drug combination. A second set of guide RNAs can be designed to distinguish microbes at the species level. Thus, a matrix can be produced identifying all species or subspecies of mosquito-borne parasites, further broken down according to drug resistance. The foregoing is for example purposes only. Other means of classifying other types of mosquito-borne parasites are also contemplated and would follow the general structure described above.
[00520] [00520] In certain exemplary embodiments, the devices, systems, and methods disclosed herein can be used to screen for genes of interest from mosquito-borne parasites, for example, drug resistance genes. Guide RNAs can be designed to distinguish between known genes of interest. Samples, including clinical samples, can then be screened using the modalities disclosed herein to detect one or more such genes. The ability to screen for drug resistance in the POC would be of tremendous benefit in selecting an appropriate treatment regimen. In certain exemplary embodiments, drug resistance genes are genes that encode proteins such as carrier proteins, such as proteins from the drug/metabolite transporter family, the ATP-binding cassette (ABC) protein involved in substrate translocation, such as transporter subfamily C or the Na+/H+ exchanger; proteins involved in the folate pathway,
[00521] [00521] In some embodiments, a CRISPR system, detection system, or methods of using the same, as described herein, may be used to determine the course of a mosquito-borne parasite outbreak.
[00522] [00522] The pathogen transmission pattern may comprise continued new transmissions from the natural reservoir of the mosquito-borne parasite or other transmissions (eg, through mosquitoes) after a single transmission from the natural reservoir or a mixture of both. In one embodiment, the target sequence is preferably a sequence within the genome of the mosquito-borne parasite or fragments thereof. In one embodiment, the pattern of transmission of mosquito-borne parasites is the initial pattern of transmission of mosquito-borne parasites, that is, at the beginning of the outbreak of mosquito-borne parasites. Determining the pattern of transmission of mosquito-borne parasites early in the outbreak increases the likelihood of stopping the outbreak as early as possible, thus reducing the possibility of local and international spread.
[00523] [00523] Determining the transmission pattern of mosquito-borne parasites may comprise detecting a sequence of mosquito-borne parasites, in accordance with the methods described herein. Determining the pattern of pathogen transmission may further comprise detecting shared intra-host variations in the sequence of mosquito-borne parasites among subjects and determining whether the shared intra-host variations show temporal patterns. Patterns in observed intrahost and interhost variation provide important information about transmission and epidemiology (Gire, et al., 2014).
[00524] [00524] In addition to other sample types disclosed herein, the sample may be derived from one or more mosquitoes, for example, the sample may comprise mosquito saliva.
[00525] [00525] In other embodiments, the invention provides methods for detecting a target nucleic acid in a sample, comprising contacting a sample with a nucleic acid detection system and applying said contacted sample to a lateral flow immunochromatographic assay, as described here.
[00526] [00526] As described herein, the nucleic acid detection system may comprise an RNA-based masking construct comprising a first and a second molecule, wherein the lateral flow immunochromatographic assay comprises detecting the first and second molecules, preferably at discrete detection locations in a lateral flow range. The first and second molecules can be detected by binding an antibody that recognizes said first or second molecule and detecting said bound molecule, preferably with sandwich antibodies.
[00527] [00527] As described elsewhere herein, the lateral flow band may comprise a first upstream antibody directed against said first molecule and a second downstream antibody directed against said second molecule. The uncleaved RNA-based masking construct is bound by said first antibody if the target nucleic acid is not present in said sample, and the cleaved RNA-based masking construct is bound by both said first antibody and second antibody if the nucleic acid target is present in said sample. SIDE FLOW DEVICES
[00528] [00528] In some embodiments, the invention provides a lateral flow device comprising a substrate comprising a first end, two or more CRISPR effector systems, two or more detection constructs, one or more first capture regions, each comprising a first binding agent, two or more second capture regions, each comprising a second binding agent. Each of the two or more CRISPR effector systems comprises a CRISPR effector protein and one or more guide sequences, each guide sequence configured to bind one or more target molecules. The first end comprises a sample loading portion and a first region loaded with a detectable linker.
[00529] [00529] As described above, each of the two or more detection constructs may comprise an RNA or DNA oligonucleotide, comprising a first molecule at a first end and a second molecule at a second end.
[00530] [00530] In some embodiments, the lateral flow device may comprise two CRISPR effector systems and two detection constructs. In some embodiments, the lateral flow device may comprise four CRISPR effector systems and four detection constructs.
[00531] [00531] In some embodiments, the sample loading portion may further comprise one or more amplification reagents to amplify one or more target molecules, as described herein.
[00532] [00532] In some embodiments, a first detection construct may comprise FAM as a first molecule and biotin as a second molecule or vice versa and a second detection construct may comprise FAM as a first molecule and Digoxigenin (DIG) as a second molecule or vice versa.
[00533] [00533] As described elsewhere herein, the CRISPR effector protein can be either an RNA-targeted or a DNA-targeted effector protein.
[00534] [00534] As described elsewhere herein, the CRISPR effector protein may be a DNA-targeted effector protein. In some embodiments, the DNA-targeting effector protein may be Cas12a.
[00535] [00535] As described elsewhere herein, the CRISPR effector protein may be an RNA-targeted effector protein. In some embodiments, the RNA-targeting effector protein may be C2c2. In some embodiments, the RNA targeting effector protein may be Cas13b. BIOMARKER DETECTION
[00536] [00536] In certain exemplary embodiments, the systems, devices, and methods disclosed herein may be used for detection of biomarkers. For example, the systems, devices and methods disclosed herein can be used for SNPe detection/or genotyping. The systems, devices and methods disclosed herein may also be used for the detection of any disease state or disorder characterized by aberrant gene expression. Aberrant gene expression includes aberration in the expressed gene, location of expression, and level of expression.
[00537] [00537] In one aspect, the invention relates to a method for detecting target nucleic acids in samples, comprising: a. distributing a sample or set of samples into one or more individual discrete volumes, the individual discrete volumes comprising a CRISPR system in accordance with the invention, as described herein; B. incubating the sample or set of samples under conditions sufficient to allow binding of one or more guide RNAs to one or more target molecules; ç. activating the CRISPR effector protein through binding of one or more guide RNAs to one or more target molecules, wherein activation of the CRISPR effector protein results in the modification of the RNA-based masking construct such that a detectable positive signal is generated; and d. detect detectable positive signal, wherein detection of detectable positive signal indicates the presence of one or more target molecules in the sample.
[00538] [00538] The sensitivity of the assays described herein is well suited for the detection of target nucleic acids in a wide variety of biological sample types, including sample types in which the target nucleic acid is diluted or for which the sample material is limited.
[00539] [00539] In certain embodiments, the present invention provides steps to obtain a sample of biological fluid (eg, urine, blood plasma or serum, sputum, cerebral spinal fluid) and extract the DNA. The mutant nucleotide sequence to be detected may be a fraction of a larger molecule or may be present initially as a discrete molecule.
[00540] [00540] In certain embodiments, DNA is isolated from the plasma/serum of a cancer patient. For comparison, DNA samples isolated from neoplastic tissue and a second sample can be isolated from non-neoplastic tissue from the same patient (control), eg lymphocytes. The non-neoplastic tissue may be of the same type as the neoplastic tissue or from a different organ source. In certain embodiments, blood samples are collected and the plasma is immediately separated from the blood cells by centrifugation. Serum can be filtered and stored frozen until DNA extraction.
[00541] [00541] In certain exemplary embodiments, target nucleic acids are detected directly from a raw or unprocessed sample such as blood, serum, saliva, cerebrospinal fluid, sputum, or urine. In certain embodiments, a target nucleic acid is an RNA.
[00542] [00542] In one embodiment, circulating cells (e.g., circulating tumor cells (CTC)) can be analyzed with the present invention. Isolation of circulating tumor cells (CTC) for use in any of the methods described herein can be accomplished. Exemplary technologies that achieve specific and sensitive detection and capture of circulating cells that can be used in the present invention have been described (Mostert B, et al., Circulating tumor cells (CTCs): detection methods and their clinical relevance in breast cancer. Cancer. Treat Rev.
[00543] [00543] The present invention also provides isolation of CTCs with CTC-Chip technology. OCTC-Chip is a microfluidic-based CTC capture device, where blood flows through a chamber containing thousands of microwells coated with anti-EpCAM antibodies to which CTCs bind (Nagrath S, et al. Isolation of circulating tumor cells rare in cancer patients by microchip technology. Nature. 2007;450:1235-1239).
[00544] [00544] In certain embodiments, cell-free chromatin fragments are isolated and analyzed in accordance with the present invention. Nucleosomes can be detected in the serum of healthy individuals (Stroun et al., Annals of the New York Academy of Sciences 906: 161-168 (2000)), as well as individuals affected by a disease state. Furthermore, the serum concentration of nucleosomes is considerably higher in patients suffering from benign and malignant diseases such as cancer and autoimmune diseases (Holdenrieder et al (2001) Int JCancer 95, 114-120, Trejo-Becerril et al (2003). Int JCancer 104, 663-668 ; Kuroi et al 1999 Breast Cancer 6 , 361-364 ; Kuroi et al (2001 ) Int j Oncology 19, 143-148 ; Amoura et al (1997 ) Arth Rheum 40, 2217-2225 ; Williams et al (2001) J. Rheumatol 28, 81-94 ).
[00545] [00545] Thus, in another embodiment, isolated chromatin fragments are derived from circulating chromatin, preferably circulating mono- and oligonucleosomes. Isolated chromatin fragments can be derived from a biological sample. The biological sample may be from a subject or patient in need. The biological sample can be sera, plasma, lymph, blood, blood fractions, urine, synovial fluid, spinal fluid, saliva, circulating or mucosal tumor cells.
[00546] [00546] In certain embodiments, the present invention may be used to detect cell-free DNA (cfDNA).
[00547] [00547] In certain exemplary embodiments, the present disclosure provides detection of cfDNA directly from a patient sample. In another exemplary embodiment, the present disclosure provides enriching cfDNA using the enrichment modalities disclosed above and prior to detection of the target cfDNA.
[00548] [00548] In one embodiment, exosomes can be analyzed with the present invention. Exosomes are small extracellular vesicles that have been shown to contain RNA. Isolation of exosomes by ultracentrifugation, filtration, chemical precipitation, size exclusion chromatography and microfluidics is known in the art. In one embodiment, exosomes are purified using an exosome biomarker. Isolation and purification of exosomes from biological samples can be carried out by any known methods (see, for example, WO2016172598A1).
[00549] [00549] In certain embodiments, the present invention may be used to detect the presence of single nucleotide polymorphisms (SNPs) in a biological sample. SNPs may be related to maternity testing (eg, sex determination, fetal defects). They may be related to a criminal investigation. In one embodiment, a suspect in a criminal investigation may be identified by the present invention. Not being bound by a forensic theory based on forensic evidence may require the most sensitive assay available to detect the genetic material of a suspect or victim, because the samples tested can be limiting.
[00550] [00550] In other embodiments, SNPs associated with a disease are encompassed by the present invention. Disease-associated SNPs are well known in the art and one skilled in the art can apply the methods of the present invention to design suitable guide RNAs (see, for example, www.ncbi.nlm.nih.gov/clinvar term=human%5Borgn %5D).
[00551] [00551] In one aspect, the invention relates to a method for genotyping, such as SNP genotyping, comprising: a) distributing a sample or set of samples into one or more individual discrete volumes, the individual discrete volumes comprising a CRISPR system according to the invention, as described herein; b) incubating the sample or set of samples under conditions sufficient to allow binding of one or more guide RNAs to one or more target molecules; c) activating the CRISPR effector protein through binding of one or more guide RNAs to one or more target molecules, wherein activation of the CRISPR effector protein results in the modification of the RNA-based masking construct such that a detectable positive signal is generated; and d) detecting the detectable positive signal, wherein detection of the detectable positive signal indicates the presence of one or more target molecules characteristic of a specific genotype in the sample.
[00552] [00552] In certain embodiments, the detectable signal is compared to (e.g., by comparing signal strength) one or more standard signals, preferably a synthetic standard signal, as for example illustrated in an exemplary embodiment in FIG. 60In certain embodiments, the pattern is or corresponds to a specific genotype. In certain embodiments, the pattern comprises a particular SNP or other (single) nucleotide variation. In certain embodiments, the pattern is a genotype pattern (amplified by PCR). In certain embodiments, the pattern is or comprises DNA. In certain embodiments, the pattern is or comprises RNA. In certain embodiments, the pattern is or comprises RNA that is transcribed from DNA. In certain embodiments, the pattern is or comprises DNA that is reverse transcribed from RNA. In certain embodiments, the detectable signal is compared to one or more standards, each of which corresponds to a known genotype, such as an SNP or other (unique) nucleotide variation. In certain embodiments, the detectable signal is compared to one or more standard signals and the comparison comprises statistical analysis, such as by parametric or non-parametric statistical analysis, such as one-way or two-way ANOVA, etc. In certain embodiments, the detectable signal is compared to one or more standard signals and when the detectable signal does not deviate (statistically) significantly from the standard, the genotype is determined to be the genotype corresponding to said standard.
[00553] [00553] In other embodiments, the present invention allows rapid genotyping for emergency pharmacogenomics. In one embodiment, a single point-of-care test can be used to genotype a patient brought to the emergency room. The patient may be suspected of having a blood clot and an emergency physician will need to decide on a dosage of diluent to administer. In exemplary embodiments, the present invention may provide guidance for the administration of anticoagulants during myocardial infarction or stroke treatment based on the genotyping of markers such as VKORC1, CYP2C9 and CYP2C19. In one embodiment, the blood diluent is the anticoagulant warfarin (Holford, NH (December 1986).
[00554] [00554] In certain exemplary embodiments, the availability of genetic material to detect an SNP in a patient allows detecting SNPs without amplification of a DNA or RNA sample. In the case of genotyping, the biological sample tested is easily obtained. In certain exemplary embodiments, the incubation time of the present invention may be reduced. The assay can be performed in a period of time necessary for an enzymatic reaction to occur. One skilled in the art can perform biochemical reactions in 5 minutes (e.g. 5 minute binding). The present invention may use an automated DNA extraction device to obtain DNA from blood. The DNA can then be added to a reaction that generates a target molecule for the effector protein. Immediately after generation of the target molecule, the masking agent can be cut off and a signal detected. In exemplary embodiments, the present invention allows rapid diagnosis of POC to determine a genotype prior to administering a drug (e.g., blood thinner). In the case where an amplification step is used, all reactions take place in the same reaction in a one-step process. In preferred embodiments, the POC assay can be performed in less than one hour, preferably 10 minutes, 20 minutes, 30 minutes, 40 minutes or 50 minutes.
[00555] [00555] In certain embodiments, the systems, devices and methods disclosed herein may be used to detect the presence or level of expression of long non-coding RNAs (lncRNAs). The expression of certain lncRNAs is associated with disease status and/or drug resistance. In particular, certain LNCRNAs (eg tcons_00010506, tcons_00026344, tcons_00028298, tcons_00026380, tcons_00026380, tcons_00026521, tcons_00026521, tcons_00026521, tcons_00026521, tcons_00026521, tcons_00026521, tcons_00026521, tcons_00016127, tcons_00016127, tcons_00016127, tcons_00016127, tcons_00016127, nr_125939, nr_125939, nr_033839, tcons_00021026,
[00556] [00556] In one embodiment, the present invention may target DNA or RNA-targeted therapies (e.g., CRISPR, TALE, zinc finger proteins, RNAi), particularly in sites where rapid delivery of therapy is important to outcomes of the therapy. treatment.
[00557] [00557] Cancer cells suffer a loss of genetic material (DNA) when compared to normal cells. This deletion of genetic material by which almost all, if not all, cancers are called "loss of heterozygosity" (LOH). Loss of heterozygosity (LOH) is a serious chromosomal event that results in the loss of the entire gene and the surrounding chromosomal region. Loss of heterozygosity is a common occurrence in cancer, where it may indicate the absence of a functional tumor suppressor gene in the lost region. However, a loss can be silent because there is still a functional gene on the other chromosome of the chromosome pair. The remaining copy of the tumor suppressor gene can be inactivated by a point mutation, leading to the loss of a tumor suppressor gene. The loss of genetic material from cancer cells can result in the selective loss of one of two or more alleles of a gene vital for cell viability or cell growth at a specific locus on the chromosome.
[00558] [00558] An "LOH marker" is the DNA of a microsatellite locus, a deletion, alteration or amplification which, when compared to normal cells, is associated with cancer or other diseases. An LOH marker is often associated with the loss of a tumor suppressor gene or another gene, usually related to the tumor.
[00559] [00559] The term "microsatellites" refers to small repetitive sequences of DNA that are widely distributed in the human genome. A microsatellite is a tract of tandem-repeated (i.e. adjacent) DNA motifs that range in length from two to five nucleotides and are typically repeated from 5 to 50 times. For example, the sequence TATATATATA (SEQ. IDNo. 333) is a dinucleotide microsatellite and GTCGTCGTCGTCGTC (SEQ. IDNo. 334) is a trinucleotide microsatellite (with A being Adenine, GGuanine, CCytosine and TThymine). Somatic changes in the repeat length of such microsatellites have been shown to represent a characteristic of tumors. Guide RNAs can be designed to detect these microsatellites. Furthermore, the present invention can be used to detect changes in repeat length as well as amplifications and deletions based on quantitation of the detectable signal. Certain microsatellites are located in flanking or intronic regulatory regions of genes, or directly in gene codons.
[00560] [00560] Frequent loss of heterozygosity (LOH) in specific chromosomal regions has been reported in many types of neoplasms. Allelic losses in specific chromosomal regions are the most common genetic changes observed in a variety of neoplasms, therefore microsatellite analyzes have been applied to detect cancer cell DNA in samples of body fluids such as sputum for lung cancer and urine for breast cancer. bladder. (Rouleau et al. Nature 363, 515-521 (1993 ); and Latif, et al. Science 260, 1317-1320 (1993 )).
[00561] [00561] Thus, it is advantageous to detect LOH markers in a subject suffering from or at risk of cancer. The present invention can be used to detect LOH in tumor cells. In one embodiment, circulating tumor cells can be used as a biological sample. In preferred embodiments, cell-free DNA obtained from serum or plasma is used to non-invasively detect and/or monitor LOH. In other embodiments, the biological sample can be any sample described herein (eg, a urine sample for bladder cancer). Not being bound by theory, the present invention can be used to detect LOH markers with improved sensitivity compared to any previous method, thus providing for early detection of mutational events. In one embodiment, LOH is detected in biological fluids, where the presence of LOH is associated with the occurrence of cancer. The method and systems described here represent a significant advance over previous techniques such as PCR or tissue biopsy, providing a non-invasive, rapid and accurate method for detecting LOH of specific cancer-associated alleles.
[00562] [00562] As the method of the present invention only requires DNA extraction from body fluid such as blood, it can be performed at any time and repeatedly on a single patient. Blood can be collected and monitored for LOH before or after surgery; before, during and after treatment, such as chemotherapy, radiation therapy, gene therapy, or immunotherapy; or during follow-up examination after treatment for disease progression, stability, or recurrence. Not being bound by theory, the method of the present invention can also be used to detect the presence or subclinical recurrence of disease with a LOH marker specific to that patient, since LOH markers are specific to an individual patient's tumor.
[00563] [00563] Histone variants, DNA modifications and histone modifications indicative of cancer or cancer progression can be used in the present invention.
[00564] [00564] In certain embodiments, the method and systems of the present invention may be used in prenatal screening. In certain embodiments, cell-free DNA is used in a prenatal screening method. In certain embodiments, DNA associated with single nucleosomes or oligonucleosomes can be detected with the present invention. In preferred embodiments, detection of DNA associated with single nucleosomes or oligonucleosomes is used for prenatal screening. In certain embodiments, cell-free chromatin fragments are used in a prenatal screening method.
[00565] [00565] Prenatal diagnosis or prenatal screening refers to the testing of diseases or conditions in a fetus or embryo before birth. The aim is to detect birth defects such as neural tube defects, Down syndrome, chromosomal abnormalities, genetic disorders and other conditions such as spina bifida, cleft palate, Tay Sachs disease, sickle cell anemia, thalassemia, cystic fibrosis, muscular dystrophy and of the fragile X. Screening can also be used for prenatal sex discernment. Common testing procedures include amniocentesis, ultrasound including nuchal translucency ultrasound, serum marker testing, or genetic screening. In some cases, tests are given to determine whether the fetus will be aborted, although doctors and patients also find it helpful to diagnose high-risk pregnancies earlier so that delivery can be scheduled in a tertiary hospital where the baby can receive adequate care. .
[00566] [00566] It has been realized that there are fetal cells that are present in the mother's blood and that these cells present a potential source of fetal chromosomes for DNA-based prenatal diagnosis. In addition, fetal DNA ranges from about 2-10% of the total DNA in maternal blood. Currently available prenatal genetic testing often involves invasive procedures.
[00567] [00567] The H3 histone class consists of four different types of proteins: the main types, H3. 1 and H3. two; the substitution type, H3. 3; and the testis-specific variant, H3t. Although H3. 1 and H3. 2 are closely related, differing only in Ser96, the H3.
[00568] [00568] In one embodiment, fetal nucleosomes may be obtained from blood. In other embodiments, fetal nucleosomes are obtained from a sample of cervical mucus. In certain embodiments, a sample of cervical mucus is obtained by swabbing or washing a pregnant woman early in the second trimester or late in the first trimester of pregnancy. The sample can be placed in an incubator to release the DNA trapped in the mucus. The incubator can be set to 37°C. The sample can be shaken for approximately 15 to 30 minutes. The mucus can be further dissolved with a mukinase for the purpose of releasing DNA. The sample may also be subjected to conditions, such as chemical treatment and the like, as is well known in the art, to induce apoptosis to release fetal nucleosomes. Thus, a sample of cervical mucus can be treated with an agent that induces apoptosis, whereby fetal nucleosomes are released. With respect to enrichment of circulating fetal DNA, reference is made to patent publications USNos. 20070243549 and 20100240054.
[00569] [00569] Prenatal screening according to the present invention may be for a disease that includes, but is not limited to, Trisomy 13, Trisomy 16, Trisomy 18, Klinefelter syndrome (47, XXY), (47, XYY) and (47, XXX), Turner Syndrome, Down Syndrome (Trisomy 21), Cystic Fibrosis, Huntington's Disease, Beta Thalassemia, Myotonic Dystrophy, Sickle Cell Anemia, Porphyria, Fragile X Syndrome, Robertsonian Translocation, Angelman Syndrome, DiGeorge and Wolf-Hirschhorn Syndrome.
[00570] [00570] Various other aspects of the invention relate to the diagnosis, prognosis and/or treatment of defects associated with a wide range of genetic disorders, which are described in more detail on the website of the National Institutes of Health under the subsection Genetic Disorders (website at health.nih.
[00571] [00571] In certain embodiments, the present invention may be used to detect cancer-associated genes and mutations. In certain embodiments, mutations associated with resistance are detected. Amplification of resistant tumor cells or the appearance of resistant mutations in clonal populations of tumor cells may arise during treatment (see, for example, Burger JA, et al., Clonal evolution in patients with chronic lymphocytic leukemia who develop resistance to inhibition of BTK. Nat Commun. 2016May 20;7:11589; Landau DA, et al., Mutations driving CLL and their evolution in progression and relapse. Nature. 2015Oct 22;526(7574):525-30; Landau DA, et al. ,Clonal evolution in hematological malignancies and therapeutic implications.Leukemia.
[00572] [00572] In certain modalities, mutations occur in individual cancers that can be used to detect cancer progression. In one embodiment, mutations related to the cytolytic activity of T cells against tumors have been characterized and can be detected by the present invention (see, for example, Rooney et al., Molecular and Genetic Properties of Tumors Associated with Local Immune Cytolytic Activity, Cell.
[00573] [00573] In certain embodiments, the present invention is used to detect a cancer mutation (eg, resistance mutation) during the course of a treatment and after completion of treatment. The sensitivity of the present invention can allow non-invasive detection of clonal mutations that arise during treatment and can be used to detect a recurrence in the disease.
[00574] [00574] In certain example modalities, the detection of microRNAs (miRNA) and/or the miRNA signatures of differentially expressed miRNA can be used to detect or monitor the progression of a cancer and/or detect drug resistance for an anti-cancer therapy. cancer. Como, Nadal et al. (Nature Scientific Reports, (2015) doi: 10. 1038/srep12464) describe mRNA signatures that can be used to detect non-small cell lung cancer (NSCLC).
[00575] [00575] In certain exemplary embodiments, the presence of resistance mutations in the clonal subpopulations of cells can be used in determining a treatment regimen. In other modalities, therapies tailored to the treatment of a patient may be administered based on common tumor mutations. In certain modalities, common mutations arise in response to treatment and lead to drug resistance. In certain embodiments, the present invention can be used in monitoring patients for cells that acquire a mutation or amplification of cells that harbor such drug-resistant mutations.
[00576] [00576] Treatment with various chemotherapeutic agents, particularly with targeted therapies such as tyrosine kinase inhibitors, often leads to new mutations in target molecules that resist the activity of the therapy. Multiple strategies to overcome this resistance are being evaluated, including the development of second-generation therapies that are unaffected by these mutations and treatment with multiple agents, including those that act downstream of the resistance mutation. In an exemplary embodiment, a mutation common to ibrutinib, a molecule that targets Bruton's tyrosine kinase (BTK) and used for CLL and certain lymphomas, is a change from cysteine to serine at position 481 (BTK/C481S). Erlotinib, which targets the tyrosine kinase domain of the epidermal growth factor receptor (EGFR), is commonly used in the treatment of lung cancer, and resistant tumors invariably develop after therapy. A common mutation found in resistant clones is a threonine to methionine mutation at position 790.
[00577] [00577] Non-silent mutations shared among cancer patient populations and common resistant mutations that can be detected with the present invention are known in the art (see, for example, WO/2016/187508). In certain embodiments, drug resistance mutations can be induced by treatment with ibrutinib, erlotinib, imatinib, gefitinib, crizotinib,
[00578] [00578] Immune checkpoints are inhibitory pathways that slow or stop immune reactions and prevent excessive tissue damage from uncontrolled immune cell activity. In certain embodiments, the targeted immune checkpoint is the programmed death-1 (PD-1 or CD279) gene (PDCD1). In other embodiments, the targeted immune checkpoint is cytotoxic T-lymphocyte-associated antigen (CTLA-4). In additional embodiments, the targeted immune checkpoint is another member of the CD28 and CTLA4Ig superfamily, such as BTLA, LAG3, ICOS, PDL1, or KIR. In other additional embodiments, the targeted immune checkpoint is a member of the TNFR superfamily, such as CD40, OX40, CD137, GITR, CD27, or TIM-3.
[00579] [00579] Recently, gene expression in tumors and their microenvironments have been characterized at the cell level (see, for example, Tirosh, et al. Dissecting the multicellular ecosystem of metastatic melanoma by single cell RNA-seq. Science 352, 189- 196, doi:10.
[00580] [00580] Thus, in certain embodiments, the invention provides low-cost, rapid, multiplexed cancer detection panels for circulating DNA, such as tumor DNA, particularly to monitor disease recurrence or the development of common resistance mutations.
[00581] [00581] The modalities disclosed herein may also be useful in other immunotherapy contexts.
[00582] [00582] In certain embodiments, the present invention can be used to determine the dysfunction or activation of tumor-infiltrating lymphocytes (TIL). TILs can be isolated from a tumor using known methods. TILs can be analyzed to determine whether they should be used in adoptive cell transfer therapies. In addition, chimeric antigen receptor T cells (TCAR cells) can be analyzed for a signature of dysfunction or activation prior to administering them to a subject.
[00583] [00583] In some embodiments, C2c2 is used to assess this state of immune cells such as T cells (eg CD8+ and/or CD4+ T cells). In particular, T cell activation and/or dysfunction can be determined, for example, on the basis of genes or gene signatures associated with one or more of the T cell states.
[00584] [00584] In some embodiments, C2c2 may be used in a diagnostic test or may be used as a method to determine whether a patient is suitable for administering an immunotherapy or other type of therapy. For example, detection of gene signatures or biomarkers can be performed via c2c2 to determine whether a patient is responding to a particular treatment or, if the patient is not responding, whether this may be due to T cell dysfunction. information about the types of therapy the patient is best suited to receive. For example, whether the patient should receive immunotherapy.
[00585] [00585] In some embodiments, the systems and assays disclosed herein may allow clinicians to identify whether a patient's response to a therapy (e.g., an adoptive cell transfer therapy (ACT)) is due to cellular dysfunction and, if any, levels of upregulation and downregulation in the biomarker signature will allow problems to be resolved. For example, if a patient receiving ACT does not respond, cells administered as part of ACT can be analyzed by an assay disclosed herein to determine the relative level of expression of a biomarker signature known to be associated with cellular activation and/or states. of dysfunction. If a particular receptor or inhibitory molecule is up-regulated on TCA cells, the patient can be treated with an inhibitor of that receptor or molecule. If a particular receptor or stimulating molecule is upregulated on ACT cells, the patient can be treated with an agonist of that receptor or molecule.
[00586] [00586] In certain exemplary embodiments, the systems, methods, and devices described herein may be used to screen for gene signatures that identify a specific cell type, cell phenotype, or cell state. Likewise, through the use of methods such as packed detection, the modalities disclosed in this document can be used to detect transcriptomes. Gene expression data is highly structured, so the expression level of some genes is predictive of the expression level of others. The knowledge that gene expression data are highly structured allows us to suppose that the number of degrees of freedom in the system is small, which allows us to suppose that the basis for calculating the relative abundance of genes is scarce. It is possible to make several biologically motivated assumptions that allow Applicants to retrieve nonlinear interaction terms during subsampling without having any specific knowledge of which genes are likely to interact. In particular, if Candidates assume that the genetic interactions are low-ranked, sparse, or a combination of them, the actual number of degrees of freedom is small relative to the full combinatorial expansion, which allows Candidates to deduce the nonlinear landscape. complete with a relatively small number of perturbations. To circumvent these assumptions, analytic theories of matrix completion and compressed sensing can be used to design sub-sampled combinatorial perturbation experiments.
[00587] [00587] The modalities disclosed herein can be used in combination with other gene editing tools to confirm that a desired gene edit or edit was successful and/or to detect the presence of off-target effects. Cells that have been edited can be tracked using one or more tabs to one or more target locations. As the modalities disclosed herein use CRISPR systems, theranostic applications are also envisaged. For example, genotyping modalities disclosed herein can be used to select appropriate target loci or identify cells or cell populations required in target editing. The same or separate system can then be used to determine editing efficiency. As described in the Working Examples below, the modalities disclosed in this document can be used to design simplified theranostic pipelines in less than a week. DETECT NUCLEIC ACID MARKED ITEMS
[00588] [00588] Alternatively, the modalities described herein may be used to detect nucleic acid identifiers. Nucleic acid identifiers are non-coding nucleic acids that can be used to identify a specific article.
[00589] [00589] The application further provides C2c2 orthologs that demonstrate robust activity, making them particularly suitable for different RNA cleavage and detection applications. These applications include, but are not limited to, those described here. More particularly, an ortholog that has been shown to have stronger activity than others tested is the C2c2 ortholog identified from the organism Leptotrichia wadei (LwC2c2). The application thus provides methods for modifying a target locus of interest, comprising delivering to said locus an unnatural or engineered composition comprising a C2c2 effector protein, more particularly a C2c2 effector protein with increased activity, as described herein and one or plus component nucleic acids, wherein at least the one or more nucleic acid components are engineered, the one or more nucleic acid components directs the complex to the target of interest, and the effector protein forms a complex with one or more acid components nucleic acid and the complex binds to the target site of interest. In particular embodiments, the target locus of interest comprises RNA. The app further provides the use of Cc2 effector proteins with increased activity in RNA sequence specific interference, RNA sequence specific gene regulation, RNA or RNA or lincRNA or non-coding RNA or nuclear RNA or mRNA product screening, mutagenesis, In situ hybridization or fluorescent fluorescence.
[00590] [00590] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
[00591] [00591] Two ways to perform a C2c2 diagnostic test for DNA and RNA are provided. This protocol can also be used with protein detection variants after administration of detection aptamers. The first is a two-step reaction, where amplification and detection of C2c2 are done separately. The second is where everything is combined in a reaction and this is called a two-step reaction. It is important to keep in mind that amplification may not be necessary for higher concentration samples, so it is good to have a separate C2c2 protocol that does not have amplification built in.
[00592] [00592] The reaction buffer is: 40 mM Tris-HCl, 60 mM NaCl, pH7.3
[00593] [00593] Carry out this reaction for 20 min-3 hours at 37°C. Read with excitation: 485 nm/20 nm, emission: 528 nm/20 nm. A signal for single molecule sensitivity can be detected as early as 20 minutes, but it is clear that the sensitivity is higher for longer reaction times.
[00594] [00594] Mix this reaction and then resuspend two to three tubes of lyophilized enzyme mixture). Add 5 µl of 280 mM MgAc to the mixture to start the reaction. Preform reaction for 10 to 20 min. Each reaction is 20 µL, which is enough for up to five reactions.
[00595] [00595] The reaction buffer is: 40 mM Tris-HCl, 60 mM NaCl, pH7.3
[00596] [00596] Do this for 20 min - 3 hours. The minimum detection time is about 20 minutes to see the sensitivity of a molecule. Carrying out the reaction longer only increases the sensitivity.
[00597] [00597] The NEB kit mentioned is the HighScribe T7High Yield Kit. To resuspend the buffer, use a 1.5x concentration: resuspend three tubes of lyophilized substrate in 59 µL of buffer and use in the above mix. Each reaction is 20 µL, which is enough for 5 reactions. Single molecule sensitivity with this reaction was observed within 30 to 40 minutes.
[00598] [00598] Rapid, inexpensive, and sensitive nucleic acid detection can aid in point-of-care pathogen detection, genotyping, and disease monitoring. The RNA-targeted and RNACas13a-targeted CRISPR effector (formerly known as C2c2) exhibits a "side effect" of promiscuous RNAse activity in target recognition. Applicant combined the side effect of Cas13a with isothermal amplification to establish a CRISPR(CRISPR-Dx) based diagnosis, providing rapid detection of DNA or RNA with attomolar sensitivity and single-base mismatch specificity. Applicant used this Cas13a-based molecular detection platform called SHERLOCK (Specific High Sensitivity Enzyme Reporter) to detect specific strains of Zika and Dengue virus, distinguish pathogenic bacteria, genotype human DNA, and identify mutations in cell-free tumor DNA. . In addition, SHERLOCK reaction reagents can be lyophilized for cold chain independence and long-term storage, and easily reconstituted on paper for field applications.
[00599] [00599] The ability to rapidly detect nucleic acids with high sensitivity and single-base specificity in a portable platform can aid in disease diagnosis and monitoring, epidemiology and general laboratory tasks. Although there are methods to detect nucleic acids (1-6), they have trade-offs between sensitivity, specificity, simplicity, cost and speed. Microbial Clustered Regularly Interleaved Short Palindromic Repeats (CRISPR) and CRISPR-associated adaptive immune systems (CRISPR-Cas) contain programmable endonucleases that can be leveraged for CRISPR-based diagnosis (CRISPR-Dx). While some Cas enzymes target DNA (7, 8), effector RNA-guided effector RNases such as Cas13a (formerly known as C2c2) (8) can be reprogrammed with CRISPR RNAs (crRNAs) (9-11) to provide a platform for specific RNA detection. Upon recognition of its RNA target, activated Cas13a engages in "collateral" cleavage of nearby non-target RNAs (10). This crRNA-programmed collateral cleavage activity allows Cas13a to detect the presence of a specific RNA in vivo triggering programmed cell death (10) or in vitro by unspecific degradation of labeled RNA (10, 12). Here, the Applicant describes SHERLOCK (High Sensitivity Specific Enzyme Reporter), an in vitro nucleic acid detection platform with attomolar sensitivity based on nucleic acid amplification and 3Cas13a-mediated collateral cleavage of a commercial reporter RNA (12), allowing real-time detection of the target (Fig. 17).
[00600] [00600] For the in vivo bacterial efficiency assay, the C2c2 proteins of Leptotrichia wadei F0279 and Leptotrichia shahii were ordered as codon-optimized genes for mammalian expression (Genscript, Jiangsu, China) and cloned into pACYC184 backbones, along with the corresponding direct repeats, which flanked a lactamase-targeted beta-spacer or untargeted spacer. Spacer expression was driven by a J23119 promoter.
[00601] [00601] For protein purification, C2c2 proteins optimized for mammalian codons were cloned into the bacterial expression vector for protein purification (6x His/Twin Strep SUMO, a pET-based expression vector received as a gift from Ilya Finkelstein).
[00602] [00602] The in vivo efficiency plasmids LwC2c2 and LshC2c2 and a previously described beta-lactamase plasmid (Abudayyeh 2016) were co-transformed into competent NovaBlue Singles cells (Millipore) at 90ng and 25ng, respectively. After transformation, cell dilutions were plated on the ampicillin and coramphicol LB-agar plate and incubated overnight at 37°C. Colonies were counted the next day.
[00603] [00603] Nucleic acid targets were PCR amplified with KAPAHifi Hot Start (Kapa Biosystems), gel extracted and purified using the MinElute Gel Extraction Kit (Qiagen). Purified dsDNA was incubated with T7 polymerase overnight at 30°C using the HiScribe T7 Rapid High Throughput RNA Synthesis Kit (New England Biolabs) and the RNA was purified with the MEGAclear Transcription Cleanup Kit (Thermo Fisher) .
[00604] [00604] For the preparation of crRNA, the constructs were ordered as DNA (Integrated DNATechnologies) with a T7 promoter sequence attached. The crRNA DNA was annealed with a short T7 primer (final concentrations 10 µM) and incubated with T7 polymerase overnight at 37°C using the T7Quick High Yield RNAHiScribe Synthesis Kit (New England Biolabs). The crRNA was purified using clean RNAXP beads (Beckman Coulter) at a 2x bead to reaction volume ratio, with an additional 1.8x supplementation of isopropanol (Sigma).
[00605] [00605] Details of the NASBA reaction are described in [Pardee 2016]. For a total reaction volume of 20 µl, 6.7 µl of reaction buffer (Life Sciences, NECB-24), 3.3 µl of Nucleotide Mix (Life Sciences, NECN-24), 0.5 µl of free water of nuclease, 0.4 µl of 12.5 µM NASBA primers, 0.1 µl of RNase inhibitor (Roche, 03335402001) and 4 µl of RNA amplicon (or water for the negative control) were mounted at 4° C and incubated at 65°C for 2 min and then at 41°C for 10 min. 5 µL of the enzyme mixture (Life Sciences, NEC-1-24) was added to each reaction, and the reaction mixture was incubated at 41°C for 2 h. The NASBA primers used were 5'-AATTCTAATACGACTCACTATAGGGGGATCCTCTAGAAATATGGATT-3' (SEQIDNO: 335) and 5'-CTCGTATGTTGTGTGGAATTGT-3' (SEQIDNO: 336), and the underlined part indicates the T7 promoter sequence.
[00606] [00606] Primers for RPA were designed using the NCBIPrimer blast (Ye et al.,BMCBioinformaics 13, 134 (2012) using default parameters, with the exception of amplicon size (between 100 and 140 nt), primer melting temperatures ( between 54C and 67C) and primer size (between 30 and 35 nt.) Primers were prepared by IDT (Integrated DNA Technologies).
[00607] [00607] The RPA and RT-RPA reactions performed were according to the TwistAmp® Basic or TwistAmp® Basic RT (TwistDx) instructions, respectively, with the exception of the 280 mM increase in MgAc before the input model. Reactions were performed with 1uL inlet for 2 h at 37°C, unless otherwise noted.
[00608] [00608] C2c2 bacterial expression vectors were transformed into competent Rosetta™ 2 (DE3) pLysSSingles (Millipore) cells. A 16 ml starter culture was grown in Terrific Broth 4 growth medium (12 g/L triptone, 24 g/L yeast extract, 9.4 g/LK2HPO, 2.2 g/LKH2PO4, Sigma) (TB) was used to inoculate 4L of TB, which was incubated at 37C, 300RPM until an OD600 of 0.6.
[00609] [00609] All subsequent steps of protein purification are performed at 4°C. The cell pellet was crushed and resuspended in lysis buffer (20 mM Tris-Hcl, 500 mM NaCl, mM DTT1, pH8.0) supplemented with protease inhibitors (complete Ultra EDTA-free tablets), lysozyme and benzonase, followed by sonication ( Sonifier 450, Branson, Danbury, CT) with the following conditions: 100 amplitude for 1 second on and 2 seconds off with a total sonication time of 10 minutes. The lysate was removed by centrifugation for 1 hour at 4°C at 10,000g and the supernatant was filtered through a 0.22 micron Stericup filter (EMDMillipore). The filtered supernatant was applied to StrepTactin Sepharose (GE) and incubated with rotation for 1 hour, followed by washing the protein-bound StrepTactin resin three times in lysis buffer.
[00610] [00610] Detection assays were performed with 45nM purified LwC2c2 substrate reporter, 22.5nM crRNA, 125nM substrate reporter (Thermo Scientific RNAse Alert v2), 2µL murine RNase inhibitors, 100ng of total background RNA and varying amounts target nucleic acid target, unless otherwise indicated, in the nuclease buffer assay (40 mM Tris-HCl, 60 mM NaCl, 26 mM MgCl2, pH7.3). If the input was amplified DNA including a T7 promoter from an RPA reaction, the above C2c2 reaction was modified to include ATP1mM, GTP1mM, UTP1mM, CTP1mM and T70.6µL polymerase mixture (NEB). Reactions were allowed to proceed for 1-3 hours at 37°C (unless otherwise indicated) in a fluorescent plate reader (BioTek) with fluorescent kinetics measured every 5 minutes.
[00611] [00611] The combination of one-pot reaction, RPA-DNA amplification, conversion of T7 polymerase DNA to RNA and C2c2 detection was performed by integrating the above reaction conditions with the RPA amplification mixture.
[00612] [00612] To compare SHERLOCK quantification with other established methods, qPCR was performed on a series of ssDNA1 dilutions. A TaqMan probe and primer set (sequences below) were designed against ssDNA1 and synthesized with IDT. Assays were performed using the TaqMan Fast Advanced Advanced Master Mix (Thermo Fisher) and measured on a Roche LightCycler
[00613] [00613] To compare SHERLOCK quantification with other established methods, Applicant performed RPA on a ssDNA1 dilution series. To quantify real-time DNA accumulation, Applicant added 1x SYBRGreen II (Thermo Fisher) to the typical RPA reaction mix described above, which provides a fluorescent signal that correlates with the amount of nucleic acid. Reactions were allowed to continue for 1 hour at 37°C in a fluorescent plate reader (BioTek) with fluorescent kinetics measured every 5 minutes.
[00614] [00614] The preparation and processing of the lentivirus was based on previously known methods.
[00615] [00615] Suspected Zika-positive human serum or urine samples were inactivated with AVL buffer (Qiagen) and RNA isolation was achieved with the QIAamp viral RNA minikit (Qiagen). Isolated ORNA was converted to cDNA by mixing random primers, dNTPs and sample RNA, followed by heat denaturation for 7 minutes at 70°C. Denatured ORNA was then reverse transcribed with Superscript III (Invitrogen), incubating at 22-25°C for 10 minutes, 50°C for 45 minutes, 55°C for 15 minutes and 80°C for 10 minutes. The cDNA was then incubated for 20 minutes at 37°C with RNAse H (New England Biolabs)
[00616] [00616] 2mL of saliva was collected from volunteers who were prevented from consuming food or drinks 30 minutes before collection. Samples were then processed using the QIAamp® DNABlood Mini Kit (Qiagen) as recommended by the kit protocol. For boiled saliva samples, 400 µL of phosphate-buffered saline (Sigma) was added to 100 µL of volunteer saliva and centrifuged for 5 min at 1800 g. The supernatant was decanted and the pellet was resuspended in phosphate-buffered saline with 0.2% Triton X-100 (Sigma) before incubation at 95°C for 5 min. 1 mL of the sample was used as a direct input to the RPA reactions.
[00617] [00617] A glass fiber filter paper (Whatman, 1827-021) was autoclaved for 90 minutes (Consolidated Stills and Sterilizers, MKII) and blocked in 5% nuclease-free BSA (EMDMillipore, 126609-10GM) during night. After rinsing the papers once with nuclease-free water (Life technologies, AM9932), they were incubated with 4% RNAsecureTM (Life technologies, AM7006) at 60 °C for 20 min and washed three more times with the nuclease-free water. nuclease. The treated papers were dried for 20 min at 80°C on a hot plate (Cole-Parmer,
[00618] [00618] For experiments involving CRE detection, bacterial cultures were grown in lysogeny broth (LB) to the intermediate phase, then sedimented and subjected to gDNA extraction and purification using the Qiagen DNeasy Blood and Tissue Kit using the protocol manufacturer's for Gram-negative or Gram-positive bacteria, as appropriate. The gDNA was quantified by the Quant-It dsDNA assay in a Qubit fluorometer and its quality evaluated via the absorbance spectrum of 200-300 nm in a Nanodrop spectrophotometer.
[00619] [00619] For experiments that discriminate between E.
[00620] [00620] To confirm the concentration of the standard dilutions of ssDNA1 and ssRNA1 used in Figure 1C, the Applicant performed Digital Droplet PCR (ddPCR). For DNA quantification, droplets were made using the ddPCRSupermix for Probes (dUTP-free) with qPCRPrimeTime Probes/primer assays designed to target the ssDNA1 sequence. For RNA quantification, droplets were made using the one-step RT-ddPCR kit for probes with PrimeTime qPCR probes/primer assays designed to target the ssRNA1 sequence.
[00621] [00621] To create standards for accurate calling of genotypes from human samples, Applicant designed primers around the SNP target to amplify ~200 bp regions of human genomic DNA representing each of the two homozygous genotypes. The heterozygous pattern was then made by mixing the homozygous patterns in a 1:1 ratio.
[00622] [00622] Simulated cfDNA patterns simulating actual patient cfDNA samples were purchased from a commercial supplier (Horizon Discovery Group). These patterns were provided as four allelic fractions (100% WT and 0.1%, 1% and 5% mutant) for mutants BRAFV600E and EGFRL858R. 3 µL of these standards were provided as input to SHERLOCK.
[00623] [00623] To calculate the background subtracted fluorescence data, the initial fluorescence of the samples was subtracted to allow comparisons between different conditions. Fluorescence for background conditions (no input or no crRNA conditions) was subtracted from the samples to generate subtracted background fluorescence.
[00624] [00624] The ratios of guide to SNP or strain discrimination were calculated by dividing each guide by the sum of guide values, to adjust for the overall sample-to-sample variation. Ratios of crRNA to SNP or strain discrimination were calculated to adjust for the overall sample-to-sample variance as follows: The image portion with rId10 ratio identification was not found in the file.
[00625] [00625] The protospacer flanking site (PFS) is a specific motif present near the target site required for robust ribonuclease activity by Cas13a. OPFS is located at the 3' end of the target site and was previously characterized by LshCas13a by our group as H(not G)(1). Although this motif is similar to a protospacer adjacent motif (PAM), a sequence restriction for DNA-targeted Class 2 systems, it is functionally different in that it is not involved in preventing CRISPR loci from self-targeting in endogenous systems. . Future structural studies of Cas13a likely elucidate the importance of PFS for Cas13a:crRNA targeting complex formation and cleavage activity.
[00626] [00626] Applicant purified recombinant E. coli protein LwCas13a (Fig. 2D-E) and tested its ability to cleave a 173-nt ssRNA with every possible nucleotide of a protospacer flanking site (PFS) (A, U , C or G) (Fig. 2F). Similar to LshCas13a, LwCas13a can cleave a target with PFSA, U, or C, with less ssRNA activity with a GPFS. Although weaker activity against ssRNA1 was observed with a GPFS, the Applicant still saw robust detection for the two target sites with GPFS motifs (Table 3; crRNA rs601338 and crRNA2-targeted Zika). It is likely that HPFS is not necessary in all circumstances and that in many cases it is possible to obtain strong cleavage or collateral activity with a GPFS.
[00627] [00627] Recombase polymerase amplification (RPA) is an isothermal amplification technique that consists of three essential enzymes: a recombinase, single-stranded DNA-binding proteins (SSBs), and a strand-displacement polymerase. ORPA overcomes many technical difficulties present in other amplification strategies, particularly the polymerase chain reaction (PCR), by not requiring temperature regulation, as all enzymes operate at a constant temperature around 37°C. ORPA replaces temperature cycling by global double-stranded template melting and primer annealing with an enzymatic approach inspired by in vivo DNA replication and repair. Recombinase-primer complexes scan double-stranded DNA and facilitate the exchange of strands at complementary sites. The strand change is stabilized by the SSBs, allowing the primer to stay on. Spontaneous disassembly of the recombinase occurs in its ADP-bound state, allowing a strand-shift polymerase to invade and extend the primer, allowing for amplification without complex instrumentation unavailable in point-of-care and field settings. Cyclic repetition of this process in a tempered range of 37-42 °C results in exponential amplification of DNA. The original published formulation uses Bacillus subtilis Pol I (Bsu) as the chain-displacement polymerase, T4 uvsX as the recombinase, and T4 gp32 as the single-stranded DNA-binding protein (2), although it is unclear which components are present in the protein. . current formulation sold by TwistDx used in this study.
[00628] [00628] In addition, RPA has several limitations: 1) Although the detection of Cas13a is quantitative (Fig.
[00629] [00629] The modularity of SHERLOCK allows any amplification technique, even non-isothermal approaches, to be used prior to T7 transcription and Cas13a detection. This modularity is made possible by the compatibility of the T7 and Cas13a steps in a single reaction, allowing detection to be performed on any amplified DNA input that has a T7 promoter. Prior to using RPA, nucleic acid sequence-based amplification (NASBA) (3, 4) was attempted for our detection assay (Fig. 10). However, NASBA did not dramatically improve the sensitivity of Cas13a (Figs. 11 and 53).
[00630] [00630] Applicant demonstrates that LshCas13a target cleavage was reduced when there were two or more mismatches in the target:crRNA duplex, but was not affected by single mismatches, an observation Applicant confirmed collateral cleavage of LwCas13a (Fig.
[00631] [00631] For incompatibility detection of ZIKV and DENV strains, our complete crRNA contained two mismatches (Fig. 37A, B). Due to the high sequence divergence between the strains, the Applicant was unable to find a continuous stretch of 28 nt with only a single nucleotide difference between the two genomes. However, the Applicant predicted that the shorter crRNAs would still be functional and designed shorter 23nt crRNAs against targets in the two strains of ZIKV that included a synthetic mismatch in the spacer sequence and only one mismatch in the target sequence. These crRNAs can still distinguish African and American strains of ZIKV (Fig. 36C). Subsequent tests of 23 nt and 20 nt crRNA show that reductions in spacer length reduce activity but maintain or enhance the ability to discriminate single mismatches (Fig. 57A-G). To better understand how synthetic mismatches can be introduced to facilitate discrimination by single nucleotide mutation, Applicant placed the synthetic mismatch in the first seven spacer positions at three different spacer lengths: 28, 23, and 20 nt (Fig. 57A) . In a target with a mutation in the third position, LwCas13a shows maximum specificity when the synthetic mismatch is at position 5 of the spacer, with improved specificity at shorter spacer lengths, although with lower levels of activity in the target (Fig. 57B-G). ) Applicant also shifted the target mutation by positions 3-6 and found side-by-side synthetic differences in the spacer around the mutation (Fig. 58).
[00632] [00632] The evaluation of the synthetic patterns created from the PCR amplification of the SNP sites allows the precise identification of the genotypes (Fig. 60A, B). By calculating all comparisons (ANOVA) between the SHERLOCK results of an individual's sample and the synthetic patterns, each individual's genotype can be identified by finding the synthetic pattern that has the most similar SHERLOCK detection intensity (Gig.
[00633] [00633] For the SHERLOCK cost analysis, reagents considered of negligible cost were omitted, including DNA templates for crRNA synthesis, primers used in RPA, common buffers (MgCl2, Tris HCl, glycerol, NaCl, DTT), glass microfiber filter paper and RNAsecure reagent. For DNA models, IDT ultramer synthesis provides material for 40 in vitro transcription reactions (each sufficient for ~10,000 reactions) for ~$70, adding negligible cost to crRNA synthesis. For RPA primers, a 25 nmole IDT synthesis of a 30 nt DNA primer can be purchased for ~$10, providing material suitable for 5000SHERLOCK reactions. Glass microfiber paper is available for $0.50/sheet, which is enough for several hundred SHERLOCK reactions. The 4% RNAsecure reagent costs $7.20/mL, which is enough for 500 tests.
[00634] [00634] In addition, for all experiments except the paper assays, 384-well plates (Corning 3544) were used, at a cost of $0.036/reaction. Because of the negligible cost, this was not included in the overall cost analysis. In addition, the SHERLOCK-POC does not require the use of a plastic container as it can easily be run on paper. The reading method for
[00635] [00635] The assay and systems described herein may generally comprise a two-step process of amplification and detection. During the first step, the nucleic acid sample, RNA or DNA, is amplified, for example by isothermal amplification. During the second step, the amplified DNA is transcribed into RNA and subsequently incubated with a CRISPR effector such as C2c2 and a crRNA programmed to detect the presence of the target nucleic acid sequence. To allow detection, a reporter RNA that has been labeled with a quenched fluorophore is added to the reaction. Collateral cleavage of the reporter RNA results in deactivation of the fluorophore and allows real-time detection of the nucleic acid target (Fig. 17A).
[00636] [00636] To achieve robust signal detection, a C2c2 ortholog was identified from the organism Leptotrichia wadei (LwC2c2) and evaluated. The activity of the LwC2c2 protein was evaluated by expressing it together with a synthetic CRISPR matrix in E. coli and programming it to cleave a target site on the beta-lactamase mRNA, which leads to the death of bacteria under ampicillin selection (Fig. .
[00637] [00637] Real-time measurement of LwC2c2 RNase collateral activity was measured using a commercially available RNA fluorescent plate reader (Fig.
[00638] [00638] To increase sensitivity, an isothermal amplification step was added prior to incubation with LwC2c2. Coupling LwC2c2-mediated detection with previously used isothermal amplification approaches, such as nucleic acid sequence-based amplification (NASBA) (Compton, 1991; Pardee et al., 2016), improved sensitivity to some extent (Fig. 11). ). An alternative isothermal amplification approach was tested, recombinase polymerase amplification (RPA) (Piepenburg et al., 2006), which can be used to exponentially amplify DNA in less than two hours.
[00639] [00639] Using the example method on a DNA synthesized version of ssRNA1, it was possible to achieve attomolar sensitivity in the range of 1 to 10 molecules per reaction (Fig. 27B, left). To verify detection accuracy, the input DNA concentration was qualified with digital droplet PCR and confirmed that the lowest detectable target concentration (2 aM) was at the concentration of a single molecule per microliter. With the addition of a reverse transcription step, RPA can also amplify RNA into a form of dsDNA, allowing attomolar sensitivity in ssRNA1 to be achieved (27B, right). Likewise, the concentrations of the RNA targets were confirmed by digital droplet PCR. To assess the feasibility of the example method to function as a POC diagnostic test, the ability of all components - RPA, T7 polymerase amplification and LwC2c2 detection - to work in a single reaction was tested and found attomolar sensitivity with one version of an assay pot (Fig. 22).
[00640] [00640] It was then determined whether the test would be effective in infectious disease applications that require high sensitivity and could benefit from portable diagnosis. To test detection in a model system, lentiviruses were produced containing RNA fragments of the Zika virus genome and the related Dengue flavivirus (Dejnirattisai et al., 2016) and the number of viral particles quantified (Fig. 31A). Simulated virus levels were detected up to 2 am. At the same time, it was also possible to show a clear discrimination between these proxy viruses that contain Zika and dengue RNA fragments (Fig. 31B).
[00641] [00641] Human Zika viral RNA levels have been reported to be as low as 3 x 106 copies/mL (4.9 fM) in patient saliva and 7.2 x 105 copies/mL (1.2 fM) in the patient's serum (Barzon et al.,2016; Gourinat et al.,2015; Lanciotti et al.,2008). From patient samples obtained, concentrations as low as 1.25 x 103 copies/mL (2.1 aM) have been observed. To assess whether the assay is able to detect Zika virus from low-titer clinical isolates, viral RNA was extracted from the patients and reverse transcribed, and the resulting cDNA was used as input to the assay (Fig. 32A). Significant detection for human serum samples of Zika was observed at concentrations below 1.25 copy/uL (2.1 µM) (Fig. 32B). In addition, the signal from patient samples was predictive of Zika viral RNA copy number and could be used to predict viral load (Fig. 31F).
[00642] [00642] To determine whether the assay could be used to distinguish bacterial pathogens, the 16SV3 region was selected as an initial target, as the conserved flanking regions allow universal RPA primers to be used between bacterial species and the internal variable region, allowing species differentiation. . A panel of 5 possible targeting crRNAs was designed for pathogenic strains and isolated from E. coli and Pseudomonas aeruginosa gDNA (Fig.
[00643] [00643] The assay can also be adapted to quickly detect and distinguish bacterial genes of interest, such as antibiotic resistance genes. Carbapenem-resistant Enterobacteriaceae (CRE) are an important emerging public health challenge (Gupta et al., 2011). The assay's ability to detect carbapenem resistance genes was evaluated and whether the test could distinguish between different carbapenem resistance genes. Klebsiella pneumonia was obtained from clinical isolates harboring New Dehli metallo-beta-lactamase 1 (NDM-1) or Klebsiella pneumoniae carbapenemase (KPC) resistance genes and crRNAs designed to distinguish between the genes. All CRE had significant signal on bacteria lacking these resistance genes (Fig. 35A) and that we could significantly distinguish between KPC and NDM-1 resistance strains (Fig. 35B).
[00644] [00644] Certain RNACRISPR-guided RNase orthologs, such as LshC2c2, have been shown not to readily distinguish single-base mismatches. (Abudayyeh et al., 2016) As demonstrated here, LwC2c2 also shares this feature (Fig. 37A). To increase the specificity of the LwC2c2 cleavage, a system for introducing synthetic mismatches into the crRNA:target was developed a duplex that increases the overall mismatch sensitivity and allows for single-base mismatch sensitivity. Several crRNAs for target 1 were designed and included mismatches along the length of the crRNA (Fig. 37A) to optimize target cleavage and minimize cleavage of a target that differs by a single mismatch. These mismatches did not reduce the cleavage efficiency of ssRNA target 1, but significantly decreased the signal for a target that included an additional mismatch (ssRNA target 2).
[00645] [00645] Having demonstrated that C2c2 can be manipulated to recognize single-base mismatches, it was determined whether this manipulated specificity could be used to distinguish between closely related viral pathogens. Multiple CrRNAs were designed to detect African or American strains of Zika virus (FIG. 37A) and strains 1 or 3 of Dengue virus (Fig.
[00646] [00646] Rapid genotyping of human saliva may be useful in emergency pharmacogenomic situations or in home diagnostics. To demonstrate the potential of the disclosed modalities for genotyping, five sites were chosen to compare C2c2 detection using 23andMe genotyping data as the gold standard (Eriksson et al., 2010) (Fig. 38A). The five sites encompass a wide range of functional associations, including sensitivity to drugs such as statins or acetaminophen, norovirus susceptibility, and risk of heart disease (Table 16).
[00647] [00647] Saliva from four human subjects was collected and genomic DNA purified using a simple commercial kit in less than an hour. The four subjects had a diverse set of genotypes at the five sites, providing a large enough sample space for the test reference for genotyping. For each of the five SNP loci, an individual's genomic DNA was amplified using RPA with the appropriate primers, followed by detection with LwC2c2 and pairs of crRNAs designed to specifically detect one of two possible alleles (Fig. 38B). The assay was specific enough to distinguish alleles with high significance and infer homozygous and heterozygous genotypes. As a DNA extraction protocol was performed on saliva prior to detection, the assay was tested to determine whether it could be even more affordable for POC genotyping using saliva heated to 95°C for 5 minutes without any further extraction. The assay was able to correctly genotype two patients whose saliva was subjected only to heating for 5 minutes and then subsequent amplification and detection of C2c2 (Fig. 40B).
[00648] [00648] Because the test is highly specific for single nucleotide differences in targets, a test was developed to determine if the test was sensitive enough to detect cancer mutations in cell-free DNA (cfDNA). cfDNA fragments are a small percentage (0.1% to 5%) of wild-type cfDNA fragments (Bettegowda et al.,2014; Newman et al.,2014; Olmedillas Lopez et al.,2016; Qin et al.,2016; Qin et al.,2014; ., 2016). A significant challenge in the cfDNA field is detecting these mutations because they are typically difficult to discover given the high levels of unmutated DNA found in background blood (Bettegowda et al., 2014; Newman et al., 2014; Qin et al., 2014; Qin et al. ., 2016). A POC cfDNA cancer test would also be useful for regular screening for the presence of cancer, especially for patients at risk of remission.
[00649] [00649] The ability of the assay to detect mutant DNA in a wild-type background was determined by diluting dsDNA target 1 into an ssDNA1 background with a single mutation at the crRNA target site (Fig. 41A-B).
[00650] [00650] As the test could detect synthetic targets with allelic fractions in a clinically relevant range, it was evaluated whether the test was able to detect cancer mutations in cfDNA. RPA primers for two different cancer mutations, EGFRL858R and BRAFV600E, were designed and commercial cfDNA standards were used with 5%, 1%, and 0.1% allelic fractions that resemble real human cfDNA samples for testing. Using a pair of crRNAs that could distinguish the mutant allele from the wild-type allele (FIG. 38C), detection of the 0.1% allelic fraction was achieved for both mutant loci (Fig.
[00651] [00651] By combining the natural properties of C2c2 with isothermal amplification and a quenched fluorescent probe, the assay and systems disclosed herein have been demonstrated to be a versatile and robust method for detecting RNA and DNA and suitable for a variety of rapid diagnostics, including of infectious diseases and rapid genotyping. A major advantage of the assays and systems disclosed here is that a new POC test can be redesigned and synthesized in a matter of days for as little time as possible. $0.6/test.
[00652] [00652] As many human disease applications require the ability to detect single mismatches, a rational approach has been developed to design crRNAs to be highly specific to a single mismatch in the target sequence by introducing a synthetic mismatch into the crRNA spacer sequence. Other approaches to achieving specificity with CRISPR effectors rely on methods based on screening in dozens of guide projects (Chavez et al., 2016). Using engineered mismatch crRNAs, we demonstrated discrimination of Zika and dengue viral strains at sites that differ by a single mismatch, rapid genotyping of gDNA SNPs from human saliva, and detection of cancer mutations in cfDNA samples.
[00653] [00653] The low cost and adaptability of the test platform lends itself to other applications, including (i) RNA/DNA quantification expertise replacing specific qPCR assays such as Taqman, (ii) rapid and multiplexed detection of microarray-like RNA and (iii) other sensitive detection applications, such as the detection of nucleic acid contamination from other sources in foods. Furthermore, C2c2 could potentially be used for the detection of transcripts in biological environments, such as in cells, and given the highly specific nature of C2c2 detection, it may be possible to trace the allelic-specific expression of transcripts or disease-associated mutations in living cells. . With the wide availability of aptamers, it may also be possible to detect proteins by coupling the detection of proteins by an aptamer to the revelation of a cryptographic amplification site for RPA followed by the detection of C2c2.
[00654] [00654] To achieve robust signal detection, the Applicant identified a Leptotrichia wadei (LwCas13a) Cas13a ortholog, which exhibits higher RNA-guided RNase activity relative to Leptotrichia shahii Cas13a (LshCas13a) (10) (Fig. 2) , see also above “Characterization of LwCas13a Cleavage Requirements”).
[00655] [00655] Applicant first determined the sensitivity of SHERLOCK for detecting RNA (when coupled with reverse transcription) or DNA targets. Applicant achieved single-molecule sensitivity for RNA and DNA, as verified by digital bead PCR (ddPCR) (Fig. 27, 51, 54A, B). Atomole sensitivity was maintained when all components of SHERLOCK were combined in a single reaction, demonstrating the feasibility of this platform as a point-of-care (POC) diagnostic (Fig. 54C). OSHERLOCK has similar sensitivity levels to ddPCR and quantitative PCR (qPCR), two established sensitive nucleic acid detection approaches, while RPA alone was not sensitive enough to detect low levels of target (Fig. 55A-D). In addition, SHERLOCK shows less variation than ddPCR, qPCR, and RPA, as measured by the coefficient of variation between replicates (Fig. 55E-F).
[00656] [00656] Applicant next examined whether SHERLOCK would be effective in infectious disease applications requiring high sensitivity. Applicant produced lentiviruses containing genome fragments of the Zika virus (ZIKV) or dengue related flavivirus (DENV) (19) (Fig. 31A). SHERLOCK detected viral particles up to 2 aM and could discriminate between ZIKV and DENV (Fig. 31B). To explore the potential use of SHERLOCK in the field, the Applicant first demonstrated that lyophilized and subsequently rehydrated Cas13acrRNA complexes (20) could detect 20 fM of unamplified ssRNA1 (Fig. 33A) and that target detection was also possible in tissue paper. fiberglass (Fig. 33B). The other components of SHERLOCK are also amenable to lyophilization: RPA is supplied as a lyophilized reagent at room temperature and the Applicant has previously demonstrated that T7 polymerase tolerates lyophilization (2). In combination, lyophilization and paper staining in the Cas13a detection reaction resulted in comparable levels of sensitive detection of ssRNA1 as aqueous reactions (FIG. 33C-E). Although paper detection and lyophilization slightly reduced the absolute signal of the readout, SHERLOCK (Fig. 31C) can readily detect mock ZIKV virus at concentrations as low as 20 µM (Fig. 31D). OSHERLOCK is also able to detect ZIKV in clinical isolates (serum, urine or saliva) where titers can be as low as 2x
[00657] [00657] To increase the specificity of SHERLOCK, the Applicant introduced synthetic mismatches in the crRNA:target duplex which allows LwCas13a to discriminate between targets that differ by a single base mismatch (Fig. 36A, B; see also above "Design of mismatches of engineering"). The Applicant designed several crRNAs with synthetic mismatches in the spacer sequences to detect African or American strains of ZIKV (Fig. 37A) and DENV strains 1 or 3 (Fig. 37C). The synthetic mismatch CRRNAs detected their corresponding strains with significantly higher signal (two-tailed Student's t test; p < 0.01) than the off-target strain, allowing robust strain discrimination based on single mismatches (Fig. 37B). , D, 36C).
[00658] [00658] The SHERLOCK platform lends itself to other applications, including (i) general RNA/DNA quantification rather than specific qPCR assays such as TaqMan, (ii) rapid multiplexed detection of RNA expression, and (iii)
[00659] [00659] Applicant biochemically characterized fourteen orthologs of the newly defined CRISPR-Cas13b type VI family of RNA-guided RNA targeting enzymes to find novel candidates to improve the SHERLOCK detection technology (Figs. 83A and 85). Applicant was able to heterologically express fourteen Cas13b orthologs in E. coli and purify the proteins for an in vitro RNase activity assay (Fig. 86). As different Cas13 orthologs may have varying dibase preferences for optimal cleavage activity, Applicant generated fluorescent homopolymer RNase sensors consisting of 5As, Gs, Cs or Us to assess orthogonal cleavage preferences. Applicant incubated each ortholog with its cognate crRNA targeting a synthetic 173nt ssRNA1 and measured collateral cleavage activity using the homopolymer's fluorescent sensors (Figures 83B and 87).
[00660] [00660] To further explore the diversity of cleavage preferences of the various Cas13a and Cas13b orthologs, the Applicant developed a library-based approach to characterizing preferred motifs for endonuclease activity in response to collateral activity. Applicant used a degenerate 6-mer RNA reporter flanked by constant DNA cuffs, which allowed for amplification and reading of uncleaved sequences (Fig. 83C). Incubating this library with collateral activated Cas13 enzymes resulted in detectable cleavage and depended on the addition of target RNA (Fig. 88). Sequencing of exhausted motifs revealed an increase in library slope over digestion time (Fig. 89A), indicative of base preference, and selection of sequences above a threshold ratio produced number-enriched sequences that corresponded to cleavage of the enzymes (Fig. 89B) Enriched motif sequence logos reproduced the U preference observed for LwaCas13a and CcaCas13b and the A preference for PsmCas13b (Fig.
[00661] [00661] Applicant confirmed the collateral preferences of LwaCas13a, PsmCas13b and CcaCas13b with in vitro digestion of targets (Fig. 93). In order to improve the weak digestion of PsmCas13b, the Applicant optimized the buffer composition and enzyme concentration (Fig. 94A, B). Other additions tested on the PsmCas13b and Cas13b orthologs did not have major effects (Fig. 95A-F). Applicant also compared PsmCas13b to a previously characterized Cas13 A family member for two RNA targets and found comparable or improved sensitivity (Fig.
[00662] [00662] A key feature of the SHERLOCK technology is that it allows single molecule detection (2aM or 1molecule/µL) by LwaCas13a RNase collateral activity. To characterize the sensitivity of Cas13b enzymes, Applicant performed SHERLOCK with PsmCas13b and CcaCas13b, another highly active Cas13b enzyme with a preference for uridine (Fig. 83E). Applicant found that LwaCas13a, PsmCas13b and CcaCas13b were able to achieve 2aM detection of two different types of RNA, ssRNA1 and a synthetic Zika ssRNA (Figs. 83E; 97 and 98). To investigate the robustness of targeting with these three enzymes, the Applicant designed eleven different crRNAs, evenly spaced by ssRNA1, and found that LwaCas13a consistently achieved signal detection, while CcaCas13b and Psmcas13b showed much more variability in detection from crRNA to crRNA (Fig.
[00663] [00663] As SHERLOCK relies on exponential amplification, accurate quantification of nucleic acids can be difficult. The Applicant hypothesized that reducing the efficiency of the RPA step could improve the correlation between the amount of input and the signal of the SHERLOCK reaction. Applicant noted that the kinetics of SHERLOCK detection were very sensitive to primer concentration over a range of sample concentrations (Fig.
[00664] [00664] An advantageous feature of nucleic acid diagnostics is the ability to simultaneously detect multiple sample inputs, allowing for multiplexed detection panels or in sample controls. The orthogonal preferences of Cas13 enzymes provide the opportunity to have SHERLOCK multiplexed. Applicant can test the collateral activity of different Cas13 enzymes in the same reaction by means of fluorescent homopolymer sensors of different base identities and fluorophore colors, allowing multiple targets to be measured simultaneously (Fig. 84A). To demonstrate this concept, the Applicant designed a LwaCas13a crRNA against the Zika virus ssRNA and a PsmCas13b crRNA against the dengue virus ssRNA. Applicant found that this assay with the two sets of Cas13-crRNA complexes in the same reaction was able to identify whether Zika or dengue RNA, or both, was present in the reaction (Fig. 84B).
[00665] [00665] Applicant showed that LwaCas13a allowed detection of single nucleotide variants and that this could be applied for rapid genotyping from human saliva, but detection required two separate reactions: one for each allele-detecting crRNA. To enable single-reaction SHERLOCK genotyping, the Applicant designed a crRNALwaCas13a against the G allele and a crRNAPsmCas13b against the A allele of the SNP rs601338SNP, a variant of the FUT2 alpha(1,2)-fosyltransferase alpha gene that is associated with norovirus resistance. . Using this single-sample multiplexed approach, Applicant was able to successfully genotype four different human subjects using their saliva and accurately identify whether they were homozygous or heterozygous.
[00666] [00666] To further demonstrate the versatility of the Cas13 family of enzymes, the Applicant simulated a therapeutic approach involving Cas13, serving as a complementary diagnosis and therapy itself.
[00667] [00667] Applicnat demonstrated highly sensitive and specific detection of nucleic acids using the CRISPR-Cas13a ortholog targeting Leptotrichia wadei type VI RNA. Applicant has further demonstrated that the Cas13b family of enzymes is biochemically active and has unique properties that make them amenable to multiplexed detection of nucleic acids by SHERLOCK. By characterizing the base orthogonal preferences of Cas13b enzymes, the Applicant found specific sequences of
[00668] [00668] Multiplexed detection with SHERLOCK is possible by performing spatial multiple reactions, but sample multiplexing via orthogonal dibase preferences allows many targets to be detected at scale and at a cheaper cost. Although the Applicant has shown here the multiplexing of two inputs, the cleavage motif screens allow the design of additional orthogonal cleavage sensors (Fig. 90). LwaCas13a and CcaCas13b, which cleave the same uridine homopolymer and therefore are not orthogonal as measured by the homopolymer sensors (Fig. 83B), showed very unique cleavage preferences by the motif screens (Fig. 90). When tracking additional Cas13a, Cas13b, and Cas13c orthologs, it is likely that many orthologs will reveal unique preferences of 6 mer motifs, which theoretically could allow highly multiplexed SHERLOCK limited only by the number of spectrally unique fluorescent sensors. The highly multiplexed OSHERLOCK allows for many technological applications, especially those involving complex input detection and logic computation.
[00669] [00669] These further refinements of Cas13-based detection for visual, more sensitive, multiplexed readings allow for larger applications for nucleic acid detection, especially in environments where portable, instrument-free analysis is required. Rapid, multiplexed genotyping can inform pharmacogenomic decisions, test various characteristics of field crops, or assess the presence of co-occurring pathogens. Fast, isothermal reading increases the accessibility of this detection for settings where power or handheld readers are not available, even for rare species like circulating DNA. Enhanced CRISPR-based nucleic acid tests facilitate understanding of the presence of nucleic acids in agriculture, pathogen detection, and chronic disease.
[00670] [00670] DNA quadruplexes can be used for the detection of biomolecule analytes (Fig. 110). In one case, the OTA-aptamer (blue) recognizes the OTA, causing a conformational change that exposes the qradruplex (red) to bind hemin. The hemin-quadruplex complex has peroxidase activity that can oxidize the TMB substrate to a colored form (usually blue in solution). Applicants have created RNA forms of these quadruplexes that Cas13 can degrade as part of the collateral activity described herein. Degradation causes a loss of the RNA aptamer and therefore a loss of the color signal in the presence of the nucleic acid target. Two exemplary projects are illustrated below.
[00671] [00671] The guanines form the main base pairs that generate the quadruplex structure and then bind the hemin molecule. Applicants spaced the guanine pools with uridine (shown in bold) to allow Cas13 to degrade the quadruplex, as the dinucleotide data show that guanines are poorly degraded.
[00672] [00672] Applicants tested the two aptamer designs at two different concentrations (Fig. 111). The lowest concentration of 100nM was not enough to form colors. The 400nM condition formed color. The corresponding absorbance data for this analysis were also quantified (Fig. 112). Specifically, design 1 had the best results for b9 and design 2 had the best results for Lwa.
[00673] [00673] Applicants further tested the stability of the colorimetric change (Fig. 113). The Cas13 colorimetric change is stable after 1 hour. The LwaCas13a colorimetric signal is stable for 1 hour, while the Cas13b9 color differential is less stable. Candidates noted that even the 100nM aptamer condition now works for Cas13b9 because after one hour the color can emerge due to substrate oxidation and a color difference can be observed.
[00674] [00674] Candidates compared colorimetric detection to fluorescence detection (Fig. 114). The 2 aM concentration could be detected in both systems, however, the increase in background fluorescence was smaller than the decrease in background colormetric detection. This indicates that the colorimetric assay can provide more sensitive results.
[00675] [00675] The colorimetric assay is applicable for use as a diagnostic assay as described here. In one embodiment, quadruplexes are incubated with a test sample and the Cas13SHERLOCK system. After an incubation period to allow identification of Cas13 from a target sequence and for degradation of aptamers by collateral activity, substrate can be added. The absorbance can then be measured. In other embodiments, the substrate is included in the assay with the quadruplexes and the Cas13SHERLOCK system.
[00676] [00676] Many applications require detection of more than one target molecule in a single reaction, and therefore, we sought to create a multiplex platform that relies on unique Cas enzyme cleavage preferences (Abudayyeh et al. Science 353, aaf5573 (2016) ); Gootenberg et al.
[00677] [00677] Using these unique cleavage preferences, we were able to detect synthetic Zika virus (ZIKV) ssRNA80 in the HEX channel and synthetic dengue virus (DENV) ssRNA in the FAM channel in the same reaction (Fig.
[00678] [00678] Next, we focused on adjusting the output of the SHERLOCK signal to make it more quantitative, sensitive, and robust to extend the usefulness of the technology. OSHERLOCK relies on exponential pre-amplification, which saturates quickly and makes accurate quantification difficult, but we observed that higher concentrations of primers increased raw signal and quantitative accuracy, indicating that at lower primer concentrations, the reaction does not saturate ( Fig. 137, B and Fig. 138A-E). We tested a range of primer concentrations and found that 240nM exhibited the highest correlation between signal and input (Fig. 138F), and quantitation was sustainable over a wide range of sample concentrations up to the attomolar range (Fig. 137C and Fig. 138G). ) . Many nucleic acid detection applications, such as HIV detection (W.H. Organization in Guidelines for Using HIVTesting Technologies in Surveillance: Selection, Evaluation and Implementation: 2009Update (Geneva, 2009); Barletta et al. Am JClin Pathol
[00679] [00679] Finally, we apply SHERLOCKv2 in a simulated approach involving Cas13, serving as a complementary diagnosis and therapy itself, as Cas13 has been developed for a variety of applications in mammalian cells, including RNA knockdown, imaging and editing (Abudayyeh et al. Nature 550:280-284 (2017 ); Cox et al. Science 358: 1019-1027 (2017 )) (Fig.
[00680] [00680] The additional refinements presented here for Cas13-based detection allow for quantitative, visual, more sensitive and multiplexed readings, allowing additional applications for nucleic acid detection, especially in environments where portable and instrument-free analysis is required (Table 27) .
[00681] [00681] Expression and purification of proteins from Cas13 and Csm6 orthologs. Expression and purification of LwaCas13a were performed as described previously ( Gootenberg et al. Science 356: 438-442 (2017 )) with minor modifications and is detailed below. The orthologs LbuCas13a, LbaCas13a, Cas13b and Csm6 were expressed and purified with a modified protocol. Briefly, bacterial expression vectors were transformed into competent Rosetta™ 2 (DE3) pLysSSingles (Millipore) cells. A 12.5 mL starter culture was grown overnight in Terrific Broth 4 (Sigma) growth medium (TB), which was used to inoculate 4L of TB for growth at 37°C and 300RPM to an OD600 of 0.5 . At this time, protein expression was induced by supplementation with IPTG (Sigma) to a final concentration of 500 µM, and the cells were cooled to 18°C for 16 h for protein expression. The cells were then centrifuged at 5000g for 15 min at 4°C. The cell pellet was harvested and stored at -80°C for further purification.
[00682] [00682] All subsequent steps of protein purification were performed at 4°C. The cell pellet was crushed and resuspended in lysis buffer (20 mM Tris-HCl, 500 mM NaCl, mM DTT1, pH 8.0) supplemented with protease inhibitors (complete Ultra EDTA-free tablets), lysozyme (500µg/1 ml) and benzonase followed by high pressure cell disruption using the LM20Microfluidizer system at 27,000PSI. The lysate was removed by centrifugation for 1 hour at 4°C at 10°C.
[00683] [00683] For cation exchange and gel filtration purification, the protein was loaded onto a 5 mL HiTrap SPHP cation exchange column (GEHealthcare Life Sciences) via FPLC (AKTAPURE, 3GEHealthcare Life Sciences) and eluted over a salt gradient of 250 mM salt at 2MNaCl in elution buffer (HEPES20 mM, DTT1 mM, 5% glycerol, pH7.0; pH7.5 for LbuCas13a, LbaCas13a). The resulting fractions were tested for the presence of recombinant protein by SDS-PAGE, and the fractions containing the protein were pooled and concentrated through a Centrifugal Filter Unit (Millipore 50MWCO) at 1 mL in S200 buffer (10 mM HEPES, 1M NaCl, 5 mMMgCl2 , mM DTT2, pH7.0). The concentrated protein was loaded onto a gel filtration column (Superdex® 20010/300GL, GEHealthcare Life Sciences) via FPLC. Fractions resulting from gel filtration were analyzed by SDS-PAGE and fractions containing protein were pooled and caps exchanged in Storage Buffer (600 mM NaCl, 50 mM Tris-HCl pH7.5, 5% glycerol, mM DTT2) and frozen at -80°C for storage.
[00684] [00684] Accession numbers and plasmid maps for all proteins purified in this study are available in Table 21.
[00685] [00685] Nucleic acid targeting and crRNA preparation. Nucleic acid targets for Cas12a and genomic DNA detection were PCR amplified with NEBNext PCR master mix, gel extracted and purified using the MinElute Gel Extraction Kit (Qiagen). For RNA-based detection, purified dsDNA was incubated with T7 polymerase overnight at 30°C using the HiScribe T7Quick High Yield RNASynthesis Kit (New England Biolabs) and the RNA was purified with the MEGAclear Transcription Clean-up Kit (Thermo Fisher ).
[00686] [00686] crRNA preparation was performed as described previously (Gootenberg et al. Science 356: 438-442 (2017)) with minor modifications and is detailed below.
[00687] [00687] All crRNA sequences used in this study are available in Table 22. All DNA and RNA target sequences used in this study are available in Table 23.
[00688] [00688] Primers for RPA were designed using NCBIPrimer-BLAST (Ye et al. BMCBioinformatics 13:134 (2012)) using default parameters, with the exception of amplicon size (between 100 and 140 nt), primer melting temperatures ( between 54°C and 67°C) and primer size (between 30 and 35 nt)Primers were prepared by IDT (Integrated DNA Technologies).
[00689] [00689] The RPA and RT-RPA reactions performed were as instructed by TwistAmp® Basic or TwistAmp® Basic RT (TwistDx), respectively, with the exception that 280 mM MgAc was added before the input model. Reactions were performed with 1 mL inlet for 1 hour at 37°C, unless otherwise noted.
[00690] [00690] For SHERLOCK nucleic acid quantification, the concentration of RPA primer was tested at the standard (480nM final) and lower (240nM, 120nM, 60nM, 24nM) concentration to find the optimal concentration. RPA reactions were carried out for 20 minutes.
[00691] [00691] When multiple targets were amplified with RPA, the primer concentration was adjusted to a final concentration of 480nM. That is, 120 nM of each primer was added to two pairs of primers for duplex detection.
[00692] [00692] All RPA primers used in this study are available in Table 24.
[00693] [00693] Fluorescent Cleavage Assay. Detection assays were performed as previously described (Gootenberg et al. Science 356: 438-442 (2017)) with minor modifications and the procedure is detailed below.
[00694] [00694] All cleavage reporters used in this study are available in Table 25.
[00695] [00695] SHERLOCK nucleic acid detection. Detection assays were performed with 45 nM purified Cas13, crRNA22.5 nM, quenched fluorescent RNA reporter (125nMRNAse Alert v2, Thermo Scientific, homopolymer and dinucleotide (IDT) reporters, 250nM for polyATrilink reporter), 0, 5 µL murine RNase inhibitor (New England Biolabs), 25 ng total background human RNA (purified from HEK293FT culture) and 1 µL RPA reaction in nuclease assay buffer (20 mMHEPES, 60 mMNaCl, 6 mMMgCl2 , pH6.8), rNTP mixture (1mM final, NEB), 0.6 µLT7 polymerase (Lucigen) and 3mMMgCl2. Reactions were allowed to proceed for 1-3 h at 37°C (unless otherwise indicated) in a fluorescent plate reader (BioTek) with fluorescent kinetics measured every 5 min.
[00696] [00696] For one-pot nucleic acid detection, the detection assay was performed as previously described (Gootenberg et al. Science 356: 438-442 (2017)) with minor modifications. A single 100 µL pool reaction assay consisted of 0.48 µM forward primer, 0.48 µM reverse primer, 1x RPA rehydration buffer, varying amounts of DNA input, 45 nM LwCas13a recombinant protein, 22 .5 nM crRNA, 125 ng human RNA total background, 125 nM substrate reporter (RNase alert v2), 2.5 µL murine RNase inhibitor (New England Biolabs), 2 mMATP, 2 mMGTP, 2 mMUTP , 2 mMCTP, 1 µL of T7 polymerase mix (Lucigen), 5 mMMgCl 2 , and 14 mMMgAc. Reactions were allowed to proceed for 1-3 h at 37°C (unless otherwise indicated) in a fluorescent plate reader (BioTek) with fluorescent kinetics measured every 5 min. For the lateral flow reading, 20 µL of the combined reaction was added to 100 µL of HybriDetect 1 Assay Buffer (Milenia) and run on HybriDetect 1 lateral flow strips (Milenia).
[00697] [00697] Nucleic acid labeling for cleavage fragment analysis. Target ORNA was transcribed in vitro from a dsDNA template and purified as described above. The in vitro cleavage reaction was performed as described above for the fluorescence cleavage reaction with the following modifications. The fluorescence reporter was replaced by 1µg of target RNA and no background RNA was used. The cleavage reaction was carried out for 5 minutes (LwaCas13a) or 1 hour (PsmCas13b) at 37°C. The cleavage reaction was purified using the RNA clean &
[00698] [00698] Mass spectrometry for high resolution cleavage fragment analysis. To determine the cleavage ends produced by Cas13 collateral RNase activity by Mass Spectrometry, an in vitro cleavage reaction was performed as described above with the following modifications. The Cas13 RNA target was used at a final concentration of 1 nM, the activator Csm6 at a final concentration of 3 µM and no background RNA was used. For control reactions, the Cas13 target was replaced with UltraPure water or the standard in vitro cleavage reaction was incubated with hexaadenylate containing a 2', 3' cyclic phosphate activator in the absence of Cas13 target, Cas13 protein and Cas13 crRNA. Cleavage reactions were performed for 1h at 37°C and purified using a New England Biolabs siRNA purification protocol.
[00699] [00699] For mass spectrometry analysis, samples were diluted 1:1 with UltraGrade water and analyzed on the q-TOFBruker Impact II mass spectrometer in negative ion mode coupled to an HPLCAgilent 1290. 10 µL were injected into a PLRP column. -S (50 mm, 5 µm particle size, 1000 angstrom pore size PLRP-S column, 2.1 mm ID) using 0.1% v/v ammonium hydroxide in water as mobile phase A and acetonitrile as mobile phase B. The flow rate was kept constant over 0.3 ml/minute. Mobile phase composition started at 0%B and was maintained for the first 2 minutes. After that point, the composition was changed to 100% B for the next 8 minutes and held for one minute. The composition was then returned to 0% B for 0.1 minute and then held for the next 4.9 minutes to allow the column to re-equilibrate to starting conditions. The mass spectrometer was adjusted for large MW ions and data were acquired between m/z 400-5000. The entire mass spectrometer dataset was m/z calibrated using a sodium formate injection. Data were analyzed using Bruker Compass Data Analysis 4.3 with a license to the MaxEnt deconvolution algorithm to generate a neutral mass spectrum calculated from the negatively charged ion data.
[00700] [00700] Extraction of genomic DNA from human saliva. DNA extraction from saliva was performed as described previously (Gootenberg et al. Science 356: 438-442 (2017)) with minor modifications and is detailed below.
[00701] [00701] PCR quantification of digital droplets.
[00702] [00702] Fluorescent cleavage assay of Cas13-Csm6. Cas13-Csm6 combined fluorescent cleavage assays were performed as described for standard Cas13 fluorescent cleavage reactions with the following modifications. Csm6 protein was added at final concentration 10 nM, 400 nM Csm6 fluorescent reporter and 500 nMCsm6 activator, unless otherwise noted.
[00703] [00703] In the case where we tested a three-step Cas13-Csm6 cleavage assay, the RPA was performed normally as discussed above for varying periods and then used as input to a normal IVT reaction for varying periods. Then, 1µL of IVT was used as input for the Cas13-Csm6 reaction described in the previous paragraph.
[00704] [00704] Motif discovery tracking with library. To screen for Cas13 cleavage preference, an in vitro RNA cleavage reaction was set up as described above with the following modifications. The Cas13 target was used at 20nM, the fluorescent reporter was replaced by 1 µM DNA-RNA oligonucleotide (IDT) containing a 6-mer stretch of randomized ribonucleotides flanked by DNA loops for the preparation of the NGS library. Reactions were carried out for 60 minutes (unless otherwise stated) at 37°C. Reactions were purified using the Zymo oligo-clean kit and concentrator-5 (Zymo research) and 15µL of UltraPure water was used for elution. 10µL of purified reaction was used for reverse transcription using a gene-specific primer that binds to the DNA identifier.
[00705] [00705] Reverse transcription (RT) was performed for 45 minutes at 42 °C, according to the qScript Flex cDNA-kit protocol (quantabio). To assess cleavage efficiency and product purity, RT reactions were diluted 1:10 in water and loaded into a Small RNA kit and run on a Bioanalyzer 2100 (Agilent). Four microliters of the RT reaction were used in the first round of NGS library preparation. ONEBNext (NEB) was used to amplify first strand cDNA with a mixture of forward primers at the end of 625 nM and a reverse primer at 625 nM for 15 cycles with initial denaturation of 3 minutes at 98 °C, initial denaturation of 10 seconds at 98°C, 10s annealing at 63°C, 20s extension at 72°C and final extension extension of 2 minutes at 72°C.
[00706] [00706] Two microliters of the first round PCR reaction was used for second round amplification to attach Illumina compatible indices (NEB) for NGS sequencing. The same protocol
[00707] [00707] Reasons screen analysis. To analyze the depletion of preferred motifs from the random motif library screen, 6-mer regions were extracted from the sequence data and normalized to the overall read count for each sample. The normalized read counts were then used to generate log ratios, with bead count adjustment, between experimental conditions and corresponding controls. For Cas13 experiments, the corresponding controls did not have target RNA added; for experiments with Csm6 and RNase A, matched controls lacked enzyme. The log ratio distribution format was used to determine the cut-off points for enriched grounds. Enriched motifs were then used to determine the occurrence of 1, 2 or 3 nucleotide combinations. Motif logos were generated using Weblogo3 (Crooks et al. Genome Res 14:1188-1190 (2004)).
[00708] [00708] Phylogenetic analysis of Cas13 protein and direct repeats of cr RNA. To study ortholog clustering, several sequence alignments were generated with the Cas13a and Cas13b protein sequences in Geneious with MUSCLE and then clustered using the Euclidean distance in R with the heat map. 2Function. To study direct repeat clustering, alignments of several sequences were generated with the direct repeat sequences Cas13a and Cas13b in Geneious using the Geneious algorithm and then clustered using the Euclidean distance in R with the heat map. 2Function.
[00709] [00709] Colorimetric gold nanoparticles. An RNA oligo was synthesized from the IDT with thiols at the 5' and 3' ends (Table 25 for sequence). In order to deprotect the thiol groups, the oligo to a final concentration of 20 mM was reduced in 150 mM sodium phosphate buffer containing 100 mM DTT for 2 hours at room temperature. The oligos were then purified using NAP-5 sephadex columns (GEHealthcare) in a final volume of 700µL of water. As previously described (Zhao et al.
[00710] [00710] The nanoparticles were tested for RNase sensitivity using an RNase A assay.
[00711] [00711] Cloning of REPAIR constructs, transfection of mammalian cells, isolation of RNA and preparation of the NGS library for REPAIR. Constructs to simulate the reversion of APC mutations and guide constructs for REPAIR were cloned as described previously (Cox et al.
[00712] [00712] RNA correction using the REPAIR system was performed as previously described (Cox et al.
[00713] [00713] RNA editing fractions were independently determined by NGS as described above. ORNA was reverse transcribed with the qScript Flex kit (Quanta Biosciences) with a sequence-specific primer. First strand cDNA was amplified with the NEBNext High Fidelity 2XPCRMastermix (New England Biosciences) with a mixture of forward primers at 625nM final and a reverse primer at 625nM for 15 cycles with initial denaturation of 3min at 98°C, 10sec cycle denaturing cycle at 98°C, second annealing at 65°C, extension 30 seconds at 72°C and final extension extension 2 minutes at 72°C. Two microliters of the first round PCR reaction was used for second round PCR amplification to fix Illumina-compatible indices for NGS sequencing, with NEBNext, using the same protocol with 18 cycles. PCR products were analyzed by agarose gel electrophoresis (2% Sybr Gold E-Gel Invitrogen) and 5µL of each reaction was pooled. The pooled samples were gel extracted, quantified with the high-sensitivity Qubit DNA2 kit. 0DNA and normalized to a final concentration of 4nM and read with a 300 cycle MiSeq v2 kit (Illumina).
[00714] [00714] SHERLOCK Fluorescence Data Analysis. SHERLOCK fluorescence analysis was performed as previously described (Gootenberg et al. Science 356: 438-442 (2017)) with minor modifications and is detailed below. To calculate the background subtracted fluorescence data, the initial fluorescence of the samples was subtracted to allow comparisons between different conditions. Fluorescence for background conditions (no input or no crRNA conditions) was subtracted from the samples to generate subtracted background fluorescence.
[00715] [00715] The crRNA to SNP discrimination ratios were calculated to adjust the overall sample-to-sample variance as follows: The image part with rId10 ratio identification was not found in the file.
[00716] [00716] Promiscuous cleavage of Cas13 orthologs in the absence of a target. Some members of the Cas13 family, such as PinCas13b and LbuCas13a, demonstrate promiscuous cleavage in the presence or absence of the target, and this background activity depends on the dinucleotide reporter (Fig. 123B). This background activity was also spacer dependent for LbuCas13a (Fig. 123C-D). In some reporters, U and A dibase preferences clustered within protein similarity or DR. Interestingly, the dinucleotide preferences identified here did not correspond to the clustered Cas13 families of direct repeat or protein-like similarity (Fig. 124A-D).
[00717] [00717] Characterization of crRNA designs for PsmCas13b and CcaCas13b. To identify the optimal crRNA for detection with PsmCas13b and CcaCas13b, we tested crRNA spacer lengths from 34 to 12 nt and found that PsmCas13b had a peak sensitivity at the spacer of 30, while CcaCas13b had equivalent sensitivity above 28nt lengths, justifying the use of 30nt spacers to assess Cas13 activity (Fig. 127). To further explore the robustness of CcaCas13b and PsmCas13b targeting compared to LwaCas13a, we designed eleven different crRNAs evenly spaced by ssRNA1 and found that the collateral activity of LwaCas13a was robust to the crRNA design, while CcaCas13b and PsmCas13b showed more variability in activity between different crRNAs (Fig. 128).
[00718] [00718] Random sorting of library motifs for additional orthogonal motifs. To further explore the diversity of cleavage preferences of the Cas13a and Cas13b orthologs, we developed a library-based approach to characterizing preferred motifs for collateral endonuclease activity. We used a degenerate 6-mer RNA reporter flanked by constant DNA cuffs, which allowed for amplification and reading of uncleaved sequences (Fig. 129A). Incubation of this library with Cas13 enzymes resulted in detectable cleavage patterns that depended on the addition of target RNA (Fig. 129), and sequencing of exhausted motifs from these reactions revealed an increase in library slope over digestion time (Fig. 129C), indicative of a population of preferred motifs for cleavage. Sequence logos and dibase preferences to highly depleted motif pairs (Fig. 129D) reproduced the U-preference observed for LwaCas13a and CcaCas13b and the A-preference of PsmCas13b (Fig. 129E and Fig. 130A). We synthesized reporters of the main motifs as determined on screen to validate the findings, and found that LwaCas13a, CcaCas13a, and PsmCas13b cleaved their most preferred motifs (Fig. 130B, C). We also found several sequences that showed cleavage for only one ortholog, but not for others, which could allow for alternative orthogonal reading of dinucleotide motifs (Fig. 131).
[00719] [00719] This concept involves two analyses: FAM-T*A*rArUG*C*-Biotin (LwaCas13a Cuts) and FAM-T*A*rUrAG*C*-DIG (CcaCas13b10 Cuts). These probes link the anti-DIG line and the streptavidin line in the double plex lateral flow band. One can then look for fluorescence and detect decreases in the intensity of the line corresponding to collateral activity and thus achieve the presence of the target sequences. Other motifs or probes (poly A for PsmCas13b and DNA sensors for detection of Cas12) can also be used.
[00720] [00720] In this assay, two probes were used: • FAM-T*A*rArUG*C*-Biotin (LwaCas13a Cuts) - ssRNA1 detection • FAM-T*A*rUrAG*C*-DIG (CcaCas13b10 Cuts) - Dengue RNA detection Results are shown in Figures 103A and 103B.
[00721] [00721] Candidates designed and synthesized lateral flow tracks that allow for 4 lines and simultaneous detection of 4 targets.
[00722] [00722] The probes used were the following: • /5TYE665/T*A*rArUG*C*/3AlexF488N/ - LwaCas13a • /5TYE665/T*A*rUrAG*C*/36-FAM/ - CcaCas13b • /5TYE665/ rArArArArA/3Bio/ - PsmCas13b • /5TYE665/AAAAA/3Dig_N/ - AsCas12a Strips contain anti-Alexa-fluor-488, anti-FAM, streptavidin and anti-Dig lines, allowing detection of up to 4 targets. Tye665 dye will be detected and decreases in fluorescent line intensity will indicate the presence of the target.
[00723] [00723] Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited by those specific embodiments.
Indeed, various modifications of the described modes of carrying out the invention which are obvious to those skilled in the medical sciences are intended to be within the scope of the claims which follow. While the invention has been described in connection with specific embodiments thereof, it will be understood that it is also capable of still other modifications, and this application is intended to cover any variations, uses, or adaptations of the invention that generally follow the principles of the invention and including such departures from the present disclosure as known and customary in the art to which the invention pertains, and can be applied to the essential features set forth herein.

权利要求:
Claims (128)
[1]
1. Nucleic acid detection system, characterized in that it comprises: i) two or more CRISPR systems, each CRISPR system comprising a Cas protein and a guide molecule comprising a guide sequence capable of binding to a corresponding target molecule and designed to form a complex with the Cas protein; and ii) a set of detection constructs, each detection construct comprising a cutting motif sequence that is preferentially cleaved by one of the Cas proteins, wherein the Cas protein of each CRISPR system exhibits collateral nucleic acid cleavage activity and cleaves preferably the cutting motif sequence of one or more of the set of detection constructs.
[2]
2. System for detecting the presence of two or more target polypeptides in an in vitro sample, characterized in that it comprises: i) a set of detection constructs, each detection construct comprising a sequence of cut motifs that is preferably cut by one of the Cas proteins, ii) a set of detection aptamers, each designed to bind to one of the two or more target polypeptides, and each detection aptamer comprising a sequence of cutting motifs that is preferentially cut by a Cas protein from a of the two or more CRISPR Systems; a masked RNA polymerase promoter binding site or a masked primer binding site; and a trigger sequence template, encoding a trigger sequence; iii) two or more CRISPR systems, each CRISPR system comprising a Cas protein and a leader polynucleotide comprising a leader sequence capable of binding the trigger sequence encoded by the trigger sequence template; wherein the Cas protein exhibits collateral nucleic acid cleaving activity and cleaves the non-target sequence of the nucleic acid-based mask construct once activated by the trigger sequence.
[3]
3. System according to claim 1, characterized in that it further comprises nucleic acid amplification reagents to amplify the target sequence.
[4]
4. System according to claim 2, characterized in that it further comprises nucleic acid amplification reagents to amplify the target sequence.
[5]
5. System according to any one of the preceding claims, characterized in that the two or more CRISPR systems are RNA-targeted Cas proteins, DNA-targeted Cas proteins, or a combination thereof.
[6]
6. System according to claim 5, characterized in that the RNA-directed Cas protein comprises one or more HEPN domains.
[7]
7. System according to claim 6, characterized in that the one or more HEPN domains comprise a sequence of RxxxxH motifs.
[8]
8. System according to claim 6, characterized in that the RxxxH motif comprises a sequence R{N/H/K]X1X2X3H.
[9]
9. System according to claim 8, characterized in that X1 is R, S, D, E, Q, N, G or Y and X2 is independently I, S, T, V or L and X3 is independently L, F, N, Y, V, I, S, D, E or A.
[10]
10. System according to any one of claims 1 to 9, characterized in that the Cas protein is a Cas13 protein directed to CRISPR RNA.
[11]
11. System according to claim 10, characterized in that the Cas13 protein is a Cas13a, Cas13b or Cas13c protein.
[12]
12. System according to claim 11, characterized in that the Cas13 protein is a Cas13 a protein.
[13]
13. System according to claim 12,
characterized by the fact that the Cas13a protein is from an organism of a genus selected from the group consisting of: Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, and Lachnospira.
[14]
14. System according to claim 12, characterized in that the Cas13a protein is selected from Table 1, Table 2 or a combination thereof.
[15]
15. System according to claim 11, characterized in that the Cas13 protein is a Cas13b protein.
[16]
16. System according to claim 15, characterized in that the Cas13b protein is from an organism of a genus selected from the group consisting of: Bergeyella, Prevotella, Porphyromonas, Bacterioides, Alistipes, Riemerella, Myroides, Capnocytophaga, Porphyromonas , Flavobacterium, Porphyromonas, Chryseobacterium, Paludibacter, Psychroflexus, Riemerella, Phaeodactylibacter, Sinomicrobium, Reichenbachiella.
[17]
17. System according to claim 15, characterized in that the Cas13b protein is selected from Table 4, 5 or a combination thereof.
[18]
18. System according to claim 11, characterized in that the Cas13 protein is a Cas13c protein.
[19]
19. System according to claim 18, characterized in that the Cas13c protein is from an organism of a genus selected from the group consisting of: Fusobacterium and Anaerosalibacter.
[20]
20. System according to claim 18, characterized in that the Cas13c protein is selected from Table 6.
[21]
21. System according to claim 5, characterized in that the DNA-directed Cas protein is a Cas12 protein.
[22]
22. System according to claim 21, characterized in that the Cas12 protein is Cpf1.
[23]
23. System according to claim 22, characterized in that Cpf1 is selected from an organism of the genus consisting of; Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria,
Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Methylobacterium or Acidaminococcus; for example, a chimeric Cas protein comprising a first fragment and a second fragment, wherein each of the first and second fragments is selected from a Cpf1 from an organism comprising Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria , Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfoviumbrio , Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Methylobacterium or Acidaminococcus.
[24]
24. System according to claim 23, characterized in that Cpf1 is selected from one or more of the following Acidaminococcus sp. BV3L6 Cpf1 (AsCpf1); Francisella tularensis subsp. Novicide U112 Cpf1 (FnCpf1);
L. bacterium MC2017 Cpf1 (Lb3Cpf1); Butyrivibrio proteoclasticus Cpf1 (BpCpf1); Parcubacteria bacterium GWC2011_GWC2_44_17 Cpf1 (PbCpf1); Peregrinibacteria bacterium GW2011_GWA_33_10 Cpf1 (PeCpf1); Leptospira inadai Cpf1 (LiCpf1); Smithella sp. SC_K08D17 Cpf1 (SsCpf1); L.
bacterium MA2020 Cpf1 (Lb2Cpf1); Porphyromonas crevioricanis Cpf1 (PcCpf1); Porphyromonas macacae Cpf1 (PmCpf1); Candidatus Methanoplasma termitum Cpf1 (CMtCpf1); Eubacterium eligens Cpf1 (EeCpf1); Moraxella bovoculi 237 Cpf1 (MbCpf1); Prevotella disiens Cpf1 (PdCpf1); or L.
bacterium ND2006 Cpf1 (LbCpf1).
[25]
25. System according to claim 22, characterized in that the Cas12 system is a C2c1 system.
[26]
26. System according to claim 25, characterized in that C2c1 is selected from an organism of the genus consisting of Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium , Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae.
[27]
27. System according to claim 26, characterized in that C2c1 is selected from one or more of Alicyclobacillus acidoterrestris (for example, ATCC
49025), Alicyclobacillus contaminans (e.g. DSM 17975), Alicyclobacillus macrosporangiidus (e.g. DSM 17980), Bacillus hisashii C4 strain, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g. DSM 10711), Desulfonatronum thiodismutans (e.g. strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus 72 Bacillus 72 SMus bacterium thermoamylovorans (e.g. strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirhabdium butyrativorans (eg, DSM 18734), Alicyclobacillus herbarius (eg, DSM 13609), Citrobacter freundii (eg, ATCC 8090), Brevibacillus agri (eg, BAB-2500), Methylobacterium nodulans (eg, ORS 2060).
[28]
28. System according to claim 1, characterized in that the two or more CRISPR systems comprise two or more Cas13 proteins, two or more Cas12 proteins or a combination of Cas13 and Cas12 proteins.
[29]
29. System according to any one of claims 1 to 28, characterized in that the mask construct suppresses the generation of a detectable positive signal until cleaved by an activated Cas CRISPR protein.
[30]
30. System according to claim 29, characterized in that the mask construct suppresses the generation of a detectable positive signal by masking the detectable positive signal or generating a detectable negative signal instead.
[31]
31. System according to claim 29, characterized in that the mask construct comprises a silencing RNA that suppresses the generation of a gene product encoded by a reporter construct, in which the gene product generates the positive signal detectable when expressed.
[32]
32. System according to claim 29, characterized in that the mask construct is a ribozyme that generates a detectable negative signal and in which the detectable positive signal is generated when the ribozyme is deactivated.
[33]
33. System according to claim 32, characterized in that the ribozyme converts a substrate to a first color and in which the substrate converts to a second color when the ribozyme is deactivated.
[34]
34. System according to claim 29, characterized in that the mask construct is a DNA or RNA aptamer and/or comprises an inhibitor tied to DNA or RNA.
[35]
35. System according to claim 34, characterized in that the aptamer or inhibitor tied to DNA or RNA sequesters an enzyme, in which the enzyme generates a detectable signal upon release of the aptamer or inhibitor tied to DNA or RNA, acting on a substrate.
[36]
36. System according to claim 34, characterized in that the aptamer is an inhibitory aptamer that inhibits an enzyme and prevents the enzyme from catalyzing the generation of a detectable signal from a substance or in which the inhibitor is tied to DNA or RNA inhibits an enzyme and prevents the enzyme from catalyzing generation of a detectable signal from a substrate.
[37]
37. System according to claim 36, characterized in that the enzyme is thrombin and the substrate is para-nitroanilide covalently linked to a peptide substrate for thrombin or 7-amino-4-methylcoumarin covalently linked to a substrate of thrombin. peptide to thrombin.
[38]
38. System according to claim 34, characterized in that the aptamer sequesters a pair of agents that when released from the aptamers combine to generate a detectable signal.
[39]
39. System according to claim 29, characterized in that the mask construct comprises a DNA or RNA oligonucleotide to which a detectable ligand and a mask component are attached.
[40]
40. System according to claim 29, characterized in that the mask construct comprises a nanoparticle held together by bridging molecules, in which at least a portion of the bridging molecules comprises DNA or RNA and in which the solution undergoes a color change when the nanoparticle is disbursed in solution.
[41]
41. System according to claim 40, characterized in that the nanoparticle is a colloidal metal.
[42]
42. System according to claim 41, characterized in that the colloidal metal is colloidal gold.
[43]
43. System according to claim 29, characterized in that the mask construct comprises a quantum dot linked to one or more quenching molecules by a binding molecule, wherein at least a portion of the binding molecule comprises DNA or RNA.
[44]
44. System according to claim 43, characterized in that the mask construct comprises DNA or RNA in complex with an intercalating agent, in which the intercalating agent changes absorbance upon DNA or RNA cleavage.
[45]
45. System according to claim 44, characterized in that the intercalating agent is pyronin-Y or methylene blue.
[46]
46. System according to claim 39, characterized in that the detectable ligand is a fluorophore and the mask component is an extinguishing molecule.
[47]
47. System according to any of claims 1 to 46, characterized in that the one or more guide molecules designed to bind to the corresponding target molecules comprise a (synthetic) mismatch.
[48]
48. System according to claim 47, characterized in that said incompatibility is upstream or downstream of a SNP or other single nucleotide variation in said target molecule.
[49]
49. System according to any one of claims 1 to 48, characterized in that the one or more guide molecules are designed to detect a single nucleotide polymorphism in a target RNA or DNA, or a splice variant of a transcript of RNA.
[50]
50. System according to any one of claims 1 to 49, characterized in that the one or more guide molecules are designed to bind to one or more target molecules that are diagnostic for a disease state.
[51]
51. System according to claim 50, characterized in that the disease state is cancer.
[52]
52. System according to claim 50, characterized in that the disease state is an autoimmune disease.
[53]
53. System according to claim 50, characterized in that the disease state is an infection.
[54]
54. System according to claim 53, characterized in that the infection is caused by a virus, a bacterium, a fungus, a protozoan or a parasite.
[55]
55. System according to claim 53, characterized in that the infection is a viral infection.
[56]
56. System according to claim 55, characterized in that the viral infection is caused by a DNA virus.
[57]
57. System according to claim 56, characterized in that the DNA virus is a member of Myoviridae, Podoviridae, Siphoviridae, Alloherpesviridae, Herpesviridae (including human herpes virus and Varicella Zoster virus), Malocoherpesviridae, Lipothrixviridae, Rudiviridae , Adenoviridae, Ampullaviridae, Ascoviridae, Asfarviridae (including African swine fever virus),
Baculoviridae, Cicaudaviridae, Clavaviridae, Corticoviridae, Fuselloviridae, Globuloviridae, Guttaviridae, Hytrosaviridae, Iridoviridae, Maseilleviridae, Mimiviridae, Nudiviridae, Nimaviridae, Pandoraviridae, Papillomaviridae, Phycodnaviridae, Plasmaviridae, Polydnaviruses, Polyomaviridae (including Simian virus 40, JC virus, BK virus), Poxviridae (including cowpox and smallpox, Sphaerolipoviridae, Tectiviridae, Turriviridae, Dinodnavirus, Salterprovirus, Rhizidovirus.
[58]
58. System according to claim 55, characterized in that the viral infection is caused by a double-stranded RNA virus, a positive-sense RNA virus, a negative-sense RNA virus, a retrovirus or a combination thereof.
[59]
59. System according to claim 58, characterized in that the viral infection is caused by a Coronaviridae virus, Picornaviridae virus, Caliciviridae virus, Flaviviridae virus, Togaviridae virus, a Bornaviridae, a Filoviridae, a Paramyxoviridae, a Pneumoviridae, a Rhabdoviridae, an Arenaviridae, a Bunenaviridae, a Bunyaviridae, an Orthomyxoviridae or a Deltavirus.
[60]
60. System according to claim 59, characterized in that the viral infection is caused by Coronavirus, SARS, Poliovirus, Rhinovirus, Hepatitis A,
Norwalk Virus, Yellow Fever Virus, West Nile Virus, Hepatitis C Virus, Dengue Virus, Zika Virus, Rubella Virus, Ross River Virus, Sindbis Virus, Chikungunya Virus, Borna Disease Virus, Ebola Virus, Marburg Virus, Virus measles, mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hantavirus, Crimean-Congo hemorrhagic fever virus, influenza or Hepatitis D virus.
[61]
61. System according to claim 60, characterized in that the viral infection is caused by the Dengue fever virus.
[62]
62. System according to claim 54, characterized in that the infection is a bacterial infection.
[63]
63. System according to claim 61, characterized in that the bacterium causing the bacterial infection is Acinetobacter species, Actinobacillus species, Actinomycetes species, an Actinomyces species, Aerococcus species, an Aeromonas species, an Anaplasma species, an Alcaligenes species, a Bacillus species, a Bacteriodes species, a Bartonella species, a Bifidobacterium species, a Bordetella species, a Borrelia species, a Brucella species, a Burkholderia species, a Campylobacter species, a Capnocytophaga species, a Chlamydia species,
a Citrobacter species, a Coxiella species, a
Corynbacterium species, a Clostridium species, a
Eikenella species, an Enterobacter species, an Escherichia species, an Enterococcus species, an Ehlichia species, a
Epidermophyton species, an Erysipelothrix species, a
Eubacterium species, a Francisella species, a
Fusobacterium species, a Gardnerella species, a Gemella species, a Haemophilus species, a Helicobacter species,
a Kingella species, a Klebsiella species, a
Lactobacillus species, a Lactococcus species, a Listeria species, a Leptospira species, a Legionella species, a
Leptospira species, Leuconostoc species, a Mannheimia species, a Microsporum species, a Micrococcus species,
a Moraxella species, a Morganell species, a Mobiluncus species, a Micrococcus species, Mycobacterium species, a
Mycoplasm species, a Nocardia species, a Neisseria species, a Pasteurelaa species, a Pediococcus species,
a Peptostreptococcus species, a Pityrosporum species,
a Plesiomonas species, a Prevotella species, a
Porphyromonas species, a Proteus species, a Providencia species, a Pseudomonas species, a Propionibacteriums species, a Rhodococcus species, a Rickettsia species,
a Rhodococcus species, a Serratia species, a
Stenotrophomonas species, a Salmonella species, a
Serratia species, a Shigella species, a Staphylococcus species, a Streptococcus species, a Spirillum species, a Streptobacillus species, a Treponema species, a Tropheryma species, a Trichophyton species, a Ureaplasma species, a Veillonella species, a Vibrio species, a Yersinia species , a Xanthomonas species, or a combination thereof.
[64]
64. System according to claim 53, characterized in that the infection is caused by a fungus.
[65]
65. System according to claim 64, characterized in that the fungus is Aspergillus, Blastomyces, Candidiasis, Coccidiodomycosis, Cryptococcus neoformans, Cryptococcus gatti, sp. Histoplasma sp. (such as Histoplasma capsulatum), Pneumocystis sp. (such as Pneumocystis jirovecii), Stachybotrys (such as Stachybotrys chartarum), Mucroymcosis, Sporothrix, Tinea fungal eye infections, Exserohilum, Cladosporium, Geotrichum, Saccharomyces, a Hansenula species, a Candida species, a Kluyveromyces species, a Debaryomyces species , a Pichia species, a Penicillium species, a Cladosporium species, a Byssochlamys species or a combination thereof.
[66]
66. System according to claim 55, characterized in that the infection is caused by a protozoan.
[67]
67. System according to claim 66, characterized in that the protozoan is a Euglenozoa, a Heterolobosea, a Diplomonadida, an Amoebozoa, a Blastocystic, an Apicomplexa, or a combination thereof.
[68]
68. System according to claim 55, characterized in that the infection is caused by a parasite.
[69]
69. System according to claim 68, characterized in that the parasite is Trypanosoma cruzi (Chagas' disease), T. brucei gambiense, T. brucei rhodesiense, Leishmania braziliensis, L. infantum, L.
mexicana, L. major, L. tropica, L. donovani, Naegleria fowleri, Giardia intestinalis (G. lamblia, G. duodenalis), canthamoeba castellanii, Balamuthia madrillaris, Entamoeba histolytica, Blastocystic hominis, Babesia microti, Cryptosporidium parvum, Cyclospora cayetanensis, Plasmodium falciparum, P. vivax, P. ovale, P. malariae, and Toxoplasma gondii, or a combination thereof.
[70]
70. System according to any one of claims 1 to 67, characterized in that the reagents for amplifying target RNA molecules comprise nucleic acid sequence-based amplification (NASBA), recombinase polymerase (RPA) amplification, isothermal amplification loop-mediated amplification (LAMP), strand displacement amplification (SDA), helicase dependent amplification (HDA), nicking enzyme amplification reaction (NEAR), PCR, multiple displacement amplification (MDA), rolling circle amplification (RCA) ), ligase chain reaction (LCR) or branch amplification method (RAM).
[71]
71. System according to any one of claims 1 to 70, characterized in that it further comprises an enrichment CRISPR system, wherein the enrichment CRISPR system is designed to bind the corresponding target molecules prior to detection by the CRISPR system of detection.
[72]
72. System according to claim 71, characterized in that the CRISPR enrichment system comprises a catalytically inactive Cas CRISPR protein.
[73]
73. System according to claim 72, characterized in that the CRISPR Cas catalytically inactive protein is a catalytically inactive C2c2.
[74]
74. System according to any one of claims 71 to 73, characterized in that the Cas CRISPR enrichment protein further comprises a tag, wherein the tag is used to pull down the Cas CRISPR enrichment system or bind the CRISPR enrichment system to a solid substrate.
[75]
75. System according to claim 74, characterized in that the solid substrate is a flow cell.
[76]
76. Diagnostic device, characterized in that it comprises one or more individual discrete volumes, each individual discrete volume comprising a CRISPR system of any one of 1 to 75.
[77]
77. Diagnostic device according to claim 76, characterized in that each individual discrete volume further comprises one or more detection aptamers comprising a masked RNA polymerase promoter binding site or a masked primer binding site.
[78]
78. Device according to claims 76 or 77, characterized in that each individual discrete volume further comprises nucleic acid amplification reagents.
[79]
79. Device according to claim 76, characterized in that the target molecule is a target DNA and the individual discrete volumes further comprise a primer that binds to the target DNA and comprises an RNA polymerase promoter.
[80]
80. Device according to any one of claims 76 to 79, characterized in that the individual discrete volumes are droplets.
[81]
81. Device according to any one of claims 76 to 80, characterized in that the individual discrete volumes are defined on a solid substrate.
[82]
82. Device according to claim 81, characterized in that the individual discrete volumes are microwells.
[83]
83. Diagnostic device according to any one of claims 76 to 82, characterized in that the individual discrete volumes are defined points on a substrate.
[84]
84. Device according to claim 83, characterized in that the substrate is a substrate of flexible materials.
[85]
85. Device according to claim 84, characterized in that the substrate of flexible materials is a paper substrate or a flexible polymer-based substrate.
[86]
86. Method for detecting target nucleic acids in samples, characterized in that it comprises: distributing a sample or a set of samples to one or more individual distinct volumes, the individual distinct volumes comprising a CRISPR system of any one of claims 1 to 75 ; incubating the sample or set of samples under conditions sufficient to allow binding of the one or more guide molecules to the one or more target molecules;
activating the Cas CRISPR protein via binding of the one or more guide molecules to one or more target molecules, wherein activation of the Cas CRISPR protein results in modification of the RNA-based mask construct such that a detectable positive signal is generated; and detecting the one or more detectable positive signals, wherein detection of the one or more detectable positive signals indicates a presence of one or more target molecules in the sample.
[87]
87. Method for detecting polypeptides in samples, characterized in that it comprises: distributing a sample or a set of samples to a set of individual discrete volumes, the individual discrete volumes comprising peptide detection aptamers, a CRISPR system of any of the claims 1 to 73; incubating the sample or set of samples under conditions sufficient to allow binding of the peptide detection aptamers to one or more target molecules, wherein binding of the aptamer to a corresponding target molecule exposes the RNA polymerase binding site or the RNA polymerase binding site. primer binding resulting in the generation of a trigger RNA; activating the Cas CRISPR protein via binding of one or more guide molecules to the trigger RNA, wherein activation of the Cas CRISPR protein results in modification of the RNA-based mask construct such that a detectable positive signal is produced; and detecting the detectable positive signal, wherein detection of the detectable positive signal indicates a presence of one or more target molecules in a sample.
[88]
88. Method for detecting target nucleic acids in samples, characterized in that it comprises: contacting one or more samples with i) two or more CRISPR systems, each CRISPR system comprising a Cas protein and a guide molecule comprising a guide sequence capable of binding to a corresponding target molecule designed to form a complex with the Cas protein; and ii) a set of detection constructs, each detection construct comprising a cutting motif sequence that is preferentially cleaved by one of the Cas proteins, wherein the Cas protein of each CRISPR system exhibits collateral nucleic acid cleavage activity and cleaves preferably the cutting motif sequence of one or more of the set of detection constructs; and detecting a signal from the cleavage of the cleavage motif sequence of the detection construct, thereby detecting one or more nucleic acid target sequences in the sample.
[89]
89. Method for detecting target nucleic acids in samples, characterized in that it comprises:
contacting one or more samples with i) ii) a set of detection constructs, each detection construct comprising sequence of cleavage motifs which is preferentially cleaved by one of the proteins
house,
ii) a set of detection aptamers, each designed to bind to one of the two or more target polypeptides, and each detection aptamer comprising a sequence of cutting motifs that is preferentially cut by a Cas protein from one of the two or more systems CRISPR; a masked RNA polymerase promoter binding site or a masked primer binding site; and a trigger sequence template, encoding a trigger sequence;
iii) two or more CRISPR systems, each CRISPR system comprising a Cas protein and a leader polynucleotide comprising a leader sequence capable of binding the trigger sequence encoded by the trigger sequence template;
wherein the Cas protein exhibits collateral nucleic acid cleaving activity and cleaves the non-target sequence of the nucleic acid-based mask construct once activated by the trigger sequence; and detecting a signal from the cleavage of the cut motif sequence of the detection construct, thereby detecting one or more nucleic acid target sequences in the sample.
[90]
90. Method according to any one of claims 86 to 89, characterized in that the target molecule is a target DNA and the method further comprises binding the target DNA to a primer comprising an RNA polymerase site.
[91]
A method according to any one of claims 86 to 89, characterized in that it further comprises amplifying the sample nucleic acid or the trigger nucleic acid.
[92]
92. Method according to claim 91, characterized in that the nucleic acid amplification comprises NASBA amplification.
[93]
93. Method according to claim 91, characterized in that the nucleic acid amplification comprises RPA amplification.
[94]
94. Method according to any one of claims 88 to 93, characterized in that the sample is a biological sample or an environmental sample.
[95]
95. Method according to claim 94, characterized in that the biological sample is blood, plasma, serum, urine, feces, sputum, mucus, lymphatic fluid, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretions, a transudate, an exudate (for example, fluid obtained from an abscess or any other site of infection or inflammation), or fluid obtained from a joint (for example, a joint normal or a joint affected by disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis) or a swab of a skin surface or mucous membrane.
[96]
96. Method according to claim 94, characterized in that the environmental sample is obtained from a food sample, a paper surface, a fabric, a metal surface, a wooden surface, a plastic surface, a soil sample, a freshwater sample, a wastewater sample, a saline water sample, or a combination thereof.
[97]
97. Method according to any one of claims 88 to 96, characterized in that the one or more guide molecules are designed to detect a single nucleotide polymorphism in a target RNA or DNA, or a splice variant of a transcript of RNA.
[98]
A method according to any one of claims 88 to 97, characterized in that the one or more guide molecules are designed to bind to one or more target molecules that are diagnostic for a disease state.
[99]
99. Method according to any one of claims 97 or 98, characterized in that the one or more guide molecules are designed to bind cell-free nucleic acids.
[100]
100. Method according to claim 98, characterized in that the disease state is an infection, an organ disease, a blood disease, a disease of the immune system, a cancer, a disease of the brain and nervous disorder, an endocrine disease, a pregnancy or childbirth-related disease, an inherited disease, or an environmentally acquired disease.
[101]
101. System according to claim 50, characterized in that said disease state is distinguished by the presence or absence of a gene or transcript or polypeptide of antibiotic or drug resistance or susceptibility, preferably in a pathogen or in a cell.
[102]
102. System according to claim 50, characterized in that said target molecule is a gene or transcript or polypeptide of antibiotic or drug resistance or susceptibility.
[103]
103. System according to claim 47, characterized in that the synthetic incompatibility in said guide molecule is in position 3, 4, 5 or 6 of the spacer, preferably in position 3.
[104]
104. System according to claim 47, 48 or 100, characterized in that said incompatibility in said guide molecule is in the position
1, 2, 3, 4, 5, 6, 7, 8 or 9 of the spacer, preferably at position 5.
[105]
105. System according to claim 47 or 97, characterized in that said incompatibility is 1, 2, 3, 4 or 5 nucleotides upstream or downstream, preferably 2 nucleotides, preferably downstream of said SNP or another single nucleotide variation in said lead molecule.
[106]
106. System according to any one of claims 1 to 69 or 101 to 105, characterized in that said guide molecule comprises a spacer that is truncated with respect to a wild-type spacer.
[107]
107. System according to any one of claims 1 to 69 or 101 to 106, characterized in that said guide molecule comprises a spacer comprising less than 28 nucleotides, preferably between and including 20 to 27 nucleotides.
[108]
108. System according to any one of claims 1 to 69 or 101 to 106, characterized in that said guide molecule comprises a spacer consisting of 20 to 25 nucleotides or 20 to 23 nucleotides, such as preferably 20 or 23 nucleotides.
[109]
109. System according to any one of claims 1 to 69 or 101 to 108, characterized in that said masking construct comprises an RNA oligonucleotide designed to bind a G-quadruplex forming sequence, wherein a structure G-quadruplex is formed by the sequence of formation of G-quadruplex upon cleavage of the mask construct and wherein the G-quadruplex structure generates a detectable positive signal.
[110]
110. Method according to any one of claims 86 to 100, characterized in that it further comprises comparing the detectable positive signal with a standard (synthetic) signal.
[111]
111. A method for detecting a target nucleic acid in a sample, comprising: contacting a sample with a nucleic acid detection system as defined in any one of claims 1 to 75; and applying said contacted sample to a lateral flow immunochromatographic assay.
[112]
112. The method of claim 119, wherein said nucleic acid detection system comprises an RNA-based mask construct comprising first and second molecules, and wherein said lateral flow immunochromatographic assay comprises detect said first and second molecules, preferably at discrete detection sites in a lateral flow range.
[113]
113. Method according to claim 112, characterized in that said first molecule and said second molecule are detected by binding to an antibody that recognizes said first or second molecule and detects said bound molecule, preferably with antibodies in sandwich.
[114]
114. The method of claim 112 or 113, wherein said lateral flow lane comprises a first upstream antibody directed against said first molecule and a second downstream antibody directed against said second molecule, and wherein the uncleaved RNA-based mask construct is bound by said first antibody if the target nucleic acid is not present in said sample, and wherein the cleaved RNA-based mask construct is bound by both said first and said second antibody antibody if the target nucleic acid is present in said sample.
[115]
115. A lateral flow device, characterized in that it comprises a substrate comprising a first end, wherein the first end comprises a sample loading portion and a first region loaded with a detectable ligand, two or more Cas CRISPR systems, two or more detection constructs, one or more first capture regions each comprising a first binding agent, two or more second capture regions each comprising a second binding agent, wherein each of the two or more systems of Cas CRISPR comprises a Cas CRISPR protein and one or more leader sequences, each leader sequence configured to bind one or more target molecules.
[116]
116. Lateral flow device, according to claim 115, characterized in that each of the two or more detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule at a first end and a second molecule at a second end.
[117]
117. Lateral flow device, according to claim 116, characterized in that it comprises two Cas CRISPR systems and two detection constructs.
[118]
118. Lateral flow device, according to claim 117, characterized in that it comprises four Cas CRISPR systems and two detection constructs.
[119]
A lateral flow device according to any of claims 115 to 118, characterized in that the sample loading portion further comprises one or more amplification reagents for amplifying the one or more target molecules.
[120]
120. A lateral flow device according to claim 117, characterized in that a first detection construct comprises FAM as a first molecule and biotin as a second molecule or vice versa and a second detection construct comprises FAM as a first molecule and Digoxigenin (DIG) as a second molecule or vice versa.
[121]
121. Lateral flow device, according to claim 116, characterized in that the Cas CRISPR protein is an RNA-directed Cas protein.
[122]
122. Lateral flow device, according to claim 121, characterized in that the RNA-directed Cas protein is C2c2.
[123]
123. Lateral flow device, according to claim 121, characterized in that the RNA-directed Cas protein is Cas13b.
[124]
124. A lateral flow device according to claim 119, characterized in that a first detection construct comprises Tye665 as a first molecule and Alexa-fluor-488 as a second molecule or vice versa; wherein a second detection construct comprises Tye665 as a first molecule and FAM as a second molecule or vice versa; wherein a third detection construct comprises Tye665 as a first molecule and biotin as a second molecule or vice versa; and wherein a fourth detection construct comprises Tye665 as a first molecule and DIG as a second molecule or vice versa.
back
[125]
125. Lateral flow device, according to claim 124, characterized in that the Cas CRISPR protein is an RNA-directed or DNA-directed Cas protein.
[126]
126. Lateral flow device, according to claim 125, characterized in that the RNA-directed Cas protein is C2c2.
[127]
127. Lateral flow device, according to claim 126, characterized in that the RNA-directed Cas protein is Cas13b.
[128]
128. Lateral flow device, according to claim 126, characterized in that the DNA-directed Cas protein is Cas12a

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20210108267A1|2021-04-15|Crispr effector system based multiplex diagnostics

---

US10266886B2|2019-04-23|CRISPR effector system based diagnostics

---

KR20190140918A|2019-12-20|CRISPR effector system-based diagnostics for virus detection

---

US20200254443A1|2020-08-13|Crispr effector system based diagnostics

---

US11174515B2|2021-11-16|CRISPR effector system based diagnostics

---

US20180305773A1|2018-10-25|Crispr effector system based diagnostics for malaria detection

---

US11104937B2|2021-08-31|CRISPR effector system based diagnostics

---

US20210371926A1|2021-12-02|Crispr effector system based diagnostics

---

US11021740B2|2021-06-01|Devices for CRISPR effector system based diagnostics

---

US20200277600A1|2020-09-03|Multi-effector crispr based diagnostic systems

---

BR112018015871B1|2021-12-07|SYSTEM, METHOD AND DEVICE TO DETECT THE PRESENCE OF A TARGET NUCLEIC ACID SEQUENCE IN A SAMPLE

同族专利:

---

公开号 | 公开日

---

JP2021508460A|2021-03-11|

---

WO2019126577A2|2019-06-27|

---

EP3728613A2|2020-10-28|

---

CA3086550A1|2019-06-27|

---

RU2020124203A|2022-01-24|

---

EP3728613A4|2022-01-12|

---

WO2019126577A3|2019-08-08|

---

IL275597D0|2020-08-31|

---

AU2018392709A1|2020-07-16|

---

US20210108267A1|2021-04-15|

---

KR20200111180A|2020-09-28|

---

CN111836903A|2020-10-27|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DE102015115836A1|2015-09-18|2017-03-23|Biotype Diagnostic Gmbh|Confirmatory test for primary nucleic acid amplificates in a continuous reaction mixture and immediate evaluation by means of immunochromatographic methods|

---

CA3026112A1|2016-04-19|2017-10-26|The Broad Institute, Inc.|Cpf1 complexes with reduced indel activity|

---

SG10202010311SA|2016-04-19|2020-11-27|Broad Inst Inc|Novel Crispr Enzymes and Systems|

---

CN109642231A|2016-06-17|2019-04-16|博德研究所|VI type CRISPR ortholog and system|US20200254443A1|2017-10-04|2020-08-13|The Broad Institute, Inc.|Crispr effector system based diagnostics|

---

JP2021503278A|2017-11-01|2021-02-12|ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア|CasZ composition and usage|

---

US20220073987A1|2018-11-14|2022-03-10|The Broad Institute, Inc.|Crispr system based droplet diagnostic systems and methods|

---

EP3931313A2|2019-01-04|2022-01-05|Mammoth Biosciences, Inc.|Programmable nuclease improvements and compositions and methods for nucleic acid amplification and detection|

---

WO2020186231A2|2019-03-14|2020-09-17|The Broad Institute, Inc.|Crispr effector system based multiplex diagnostics|

---

WO2020186223A1|2019-03-14|2020-09-17|The Broad Institute, Inc.|Sherlock assays for tick-borne diseases|

---

WO2021021532A1|2019-07-26|2021-02-04|Mammoth Biosciences, Inc.|Compositions for detection of dna and methods of use thereof|

---

WO2021046257A1|2019-09-03|2021-03-11|The Broad Institute, Inc.|Crispr effector system based multiplex cancer diagnostics|

---

CN110894557A|2019-09-20|2020-03-20|武汉大学|CRRNAfor detecting African swine fever virus based on CRISPRmode and kit|

---

GB201914568D0|2019-10-09|2019-11-20|Governing Council Of The Univ Of Toronto|A molecular sensing platform and methods of use|

---

WO2021111466A1|2019-12-02|2021-06-10|Council Of Scientific & Industrial Research|Method and kit for detection of polynucleotide|

---

WO2021154866A1|2020-01-27|2021-08-05|Sherlock Biosciences|Improved detection assays|

---

US20210262025A1|2020-02-18|2021-08-26|Massachusetts Institute Of Technology|Multiplexed in vivo disease sensing with nucleic acid-barcoded reporters|

---

EP3875602A1|2020-03-05|2021-09-08|Nederlandse Organisatie voor toegepast- natuurwetenschappelijk Onderzoek TNO|Nucleic acid fluorescence detection|

---

CN111363842B|2020-04-13|2021-02-02|广州医科大学附属第一医院|Sequence, kit, method and application for rapidly detecting aspergillus fumigatus|

---

RU2745637C1|2020-04-15|2021-03-29|Федеральное бюджетное учреждение науки "Центральный научно-исследовательский институт эпидемиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека |Method for obtaining the crispr/cas ribonucleoprotein complex preparation and preparation for detection of the blavim-2pseudomonas aeruginosa antibiotic resistance gene in ultra-low concentrations|

---

WO2021222267A1|2020-04-28|2021-11-04|President And Fellows Of Harvard College|Systems and methods for determining viruses or other pathogens|

---

CN111394490B|2020-05-15|2020-12-29|中国人民解放军军事科学院军事医学研究院|CRISPR-Cas12a detection primer group for eupolyphaga and application thereof|

---

CN111996236B|2020-05-29|2021-06-29|山东舜丰生物科技有限公司|Method for detecting target nucleic acid based on CRISPR technology|

---

CN111876512A|2020-07-29|2020-11-03|深圳市疾病预防控制中心|Reagent and kit for detecting two leishmania by isothermal amplification and application of reagent and kit|

---

CN111781363A|2020-08-12|2020-10-16|江苏省农业科学院|Quantum dot microsphere immunochromatography test strip for detecting mucosa sIgA antibody of African swine fever virus and application thereof|

---

EP3954783A1|2020-08-13|2022-02-16|Deutsches Krebsforschungszentrum|Polynucleotide detection by cas nucleases|

---

WO2022038521A1|2020-08-18|2022-02-24|Regenacellx.SL|Compositions and methods for detecting sars-cov-2 spike protein|

---

CN113308451A|2020-12-07|2021-08-27|中国科学院动物研究所|Engineered Cas effector proteins and methods of use thereof|

---

CN112522444A|2020-12-22|2021-03-19|中国农业科学院兰州兽医研究所|Composition for African swine fever virus LAMP-CRISPR detection, detection kit and detection method|

---

CN113403412A|2021-06-24|2021-09-17|中国农业科学院兰州兽医研究所|Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof|

法律状态:
2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762610066P| true| 2017-12-22|2017-12-22|

---

US62/610,066|2017-12-22|

---

US201862623546P| true| 2018-01-29|2018-01-29|

---

US62/623,546|2018-01-29|

---

US201862630814P| true| 2018-02-14|2018-02-14|

---

US62/630,814|2018-02-14|

---

US201862741501P| true| 2018-10-04|2018-10-04|

---

US62/741,501|2018-10-04|

---

PCT/US2018/066940|WO2019126577A2|2017-12-22|2018-12-20|Crispr effector system based multiplex diagnostics|

---